Ranunculus allegheniensis

Britton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Ranunculus

At a glance

Occurrence records354

Data sources9

Biological traits9

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Ranunculus allegheniensis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF354 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Ranunculus allegheniensis is a species of flowering plant in the buttercup family, Ranunculaceae. Its common names include Allegheny Mountain buttercup and Allegheny crowfoot. It is found in the northeastern United States, in and around the northern segments of the Appalachian mountains., particularly in areas of high pH bedrock.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ranunculus allegheniensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJF509960.1 ↗599 bpUSA

ACGT

AAAGCAGACGACCCGCGAACACGTTAAAAAGTACCAAGGCGGATTGGCGAAGGGCGTGAGCCCCGATCCAGTCCGCTTGTCGGGCCGCGA …

Ranunculus allegheniensis internal transcribed spacer 1, partial sequence; 5.8 ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ranunculus allegheniensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · eflora

CCDB · ipcn-api-dl — Hill, L. M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 19–20.

CCDB · book-ipcn73-74 — KEENER, C.S. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.

CCDB · eflora

n 81×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Roberts 1976

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type354 records

Wild obs. + sensor48

Museum / vouchered306

Origin

Native1

Range

Area of Occupancy AOO1 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 12≤1 km 4>10 km 24

40 georeferenced · 8 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 17≤1 km 44≤10 km 140>10 km 25

226 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence306

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	126
Philadelphia, US	42
New Haven, US	15
University of Stellenboschlocation not on record	15
Johnson City, US	8
Burlington, US	8
Williamsburg, US	7
Chapel Hill, US	5
Tampa, US	5
Morgantown, US	4
University of New Hampshirelocation not on record	4
Longwood Universitylocation not on record	4
Bloomington, US	3
Bronx, US	3
Millersville, US	2
Norfolk, US	1
Northridge, US	1
Maryland Department of Natural Resourceslocation not on record	1
Auckland, NZ	1
Cambridge, US	1
College Park, US	1
Little Rock, US	1
Mohonk Preservelocation not on record	1

23 institutions · 259 of 306 vouchered records shown · 46 without an institution code

09Environmental DNA2 detections

Where the DNA of Ranunculus allegheniensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)