Ranunculus acris
speciesAt a glance
Occurrence records1 018 636
Data sources15
Biological traits58
DNA specimens59
eDNA detections39
Sources15 archives
Databases and archives Ranunculus acris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 018 632 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics59 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources58 traits
Chemical compositionLOTUS · NPASS90 compounds
Occurrence & distributionGBIF · PBDB1 018 636 records
Environmental DNA1 datasets · 9 countries39 detections
DNA & barcodingBOLD · NCBI59 specimens
Genome at a glanceCCDB · GoaT4.8 Gbp
Deep timePBDB4 fossils
01Narrative
La Renoncule âcre est une espèce de plantes herbacées vivaces de la famille des Renonculacées. Très connue dans les prairies de l'Ancien continent, elle est « l'une des plantes européennes les plus complètement naturalisées en Amérique. » Elle est connue sous le nom de « bouton d'or », même si celui-ci désigne aussi plusieurs espèces de renoncules à fleurs jaunes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVPAusTraits
Size & morphology21
Fruit length3 mm
Fruit width2 mm
Leaf length max150 mm
Leaf mass19.1 mg
Leaf size618 mm²
⚠ sources differ — TRY: 618 mm² · LEDA: 317 mm² · GIFT: 621 mm²
Leaf width120 mm
Leaf width max120 mm
Leaf width min120 mm
Plant height0.517 m
⚠ sources differ — GIFT: 0.517 m · LEDA: 0.263 m · TRY: 0.17 m
Plant height generative0.464 m
Plant height max1.2 m
Plant height min0.3 m
Seed length2.84 mm
⚠ sources differ — TRY: 2.84 mm · GIFT: 3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass1.52 mg
⚠ sources differ — TRY: 1.52 mg · LEDA: 1.79 mg · GIFT: 1.61 mg
Seed mass max1.9 mg
Seed mass min0.9 mg
Seed volume1.6 mm³
Seed volume max1.6 mm³
Seed volume min1.6 mm³
Life cycle & reproduction15
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJul
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number48.95
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTforest, forest edges, meadows
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio17.34 g/g
Leaf c439 mg/g
Leaf dry-matter content (LDMC)225 mg/g
⚠ sources differ — TRY: 225 mg/g · LEDA: 200 mg/g
Leaf n23.64 mg/g
Leaf p2.79 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)20.72 mm²/mg
⚠ sources differ — TRY: 20.72 mm²/mg · LEDA: 22.5 mm²/mg · GIFT: 23.12 mm²/mg
Wood density45.48 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition90 compounds
Compounds documented for Ranunculus acris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids42
Flavonols6
Carotenoids (C40, β-ε)3
Cinnamic acids and derivatives1
Simple coumarins1
Documented compounds90 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2R,5R,7R,10S,11R,18S,19S,22S)-7,18-dihydroxy-1,2,6,6,10,17,17-heptamethyl-20-oxahexacyclo[12.10.0.02,11.05,10.015,22.019,22]tetracosa-12,14-dien-21-one | present | NPASS | |
| (2S,3S,4R,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-6-[[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxymethyl]-3,4,5-trihydroxyoxan-2-yl]oxycarbonyl-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxyoxane-2-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-4,4,6a,6b,11,11,14b-heptamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4-hydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-6-[[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxymethyl]-3,4,5-trihydroxyoxan-2-yl]oxycarbonyl-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-carboxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-8a-carboxy-4,4,6a,6b,11,11,14b-heptamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3-[(2S,3R,4R,5S)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]oxy-4-hydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | NPASS | |
| (3R,4aR,6aR,6aS,6bR,8aR,10R,12aS)-3,10-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12-dodecahydropicene-4a-carboxylic acid | present | NPASS | |
| (3R,4aR,6aR,6aS,6bR,8aR,12aS)-3-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-10-oxo-3,4,5,6,6a,7,8,8a,11,12-decahydro-1H-picene-4a-carboxylic acid | present | NPASS | |
| (3R,4R,4aS,6aR,6aS,6bR,8aR,10R,12aS)-3,4,10-trihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12-dodecahydropicene-4a-carboxylic acid | present | NPASS | |
| (3S,4aR,6aR,6aS,6bR,8aR,12aS)-3-acetyloxy-3-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-10-oxo-1,4,5,6,6a,7,8,8a,11,12-decahydropicene-4a-carboxylic acid | present | NPASS |
05DNA & barcoding59 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ranunculus acris has left across the world's sequence archives.
At a glance
DNA specimens59
Marker genes10
GenBank sequences10
eDNA detections39
Countries10
The DNA barcodea real sequence read deposited for this species
CTTGTTGGGTCGTGGAGTCTATTGCATCCCTTGTGGTTGTGGTCGCTTTACGTCCTGGCACAACATCAAAATCCGGCGCGGTTGGCGTCA …
Ranunculus acris voucher AKM23-181 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL6★rbcLa★trnL-F★ITS3★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Ranunculus acris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 831 320 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Ranunculus acris4.83 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records12–482n range14median14mode183records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 14122×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +20
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — LOON J.C. - 1980. Chromosome number reports LXIX.. Taxon , 29(5-6): 703-730.
CCDB · ita-fl — MARCHI P., CAPINERI R., D'AMATO G. - 1975. Numeri cromosomici per la flora italiana:208-218.. Inform. Bot. Ital. , 7(3): 377-389.
CCDB · ita-fl — MARCHI P., VISONA L. - 1982. Numeri cromosomici per la flora italiana:889-905.. Inform. Bot. Ital. , 14(2-3): 248-258.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Murín A. & Paclová L., 2002: Ranunculus altitatrensis - the tetraploid species from the complex of R. acris in the flora of the Vysoké Tatry Mts. - Biologia (Bratislava) 57/1: 69-74.
CCDB · slov-fl — Paclová L., 1997: Ranunculus altitatrensis Paclová et Murín, nový taxón flóry Vysokých Tatier. - Štúdie o Tatranskom národnom parku 2 (35): 95-98.
CCDB · slov-fl — Murín A. & Paclová L., 1979: [Report], pp. 403-405. - In: Löve Á. (ed.), IOPB Chromosome number reports LXIV, Taxon 28 /4.
CCDB · slov-fl — Bernátová D., 2007: [New records in Betonica, Buphtalmum, Dianthus, Pilosella, Polygonatum, Prenanthes, Ranunculus, Silene, Solidago, Tragopogon, Trifolium, and Tussilago], pp. 125, 135, 225, 440, 461, 468, 488, 497, 547, 554, 588, 592, 596. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · brit-fl — Jones, K. (1969)
CCDB · brit-fl — Whyte, R.O. J. Genet. 21: 183-191 (1929)
CCDB · brit-fl — Harper, J.L. J. Ecol. 45: 289-342 (1957)
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1627
CCDB · fl-europaea — Bdcher, 1938a
CCDB · fl-europaea — Sokolovskaya, 1958
CCDB · poland — Tomaszewski A. 1959. Cytological studies in four species of the genus Ranunculus L. Acta Soc. Bot. Pol. 28, 695-704.
CCDB · ipcn-api-dl — Zhuravleva, E. A. & L. A. Malakhova. 1983. Karyological analysis of the buttercup species Ranunculus L. (Ranunculaceae). Citologija 25: 83–90.
CCDB · ipcn-api-dl — Marchi, P. & L. Visona. 1982. Numeri cromosomici per la Flora Italiana: 889-905. Inform. Bot. Ital. 14: 248–258.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Buttler, K. P. 1983. Chromosomenzahlen von Gefässpflanzen aus Hessen (und dem angrenzenden Bayern). 1. Folge. Hess. Florist. Briefe. 32: 23–26ý.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1983. Chromosome numbers in flowering plants from Greece. Willdenowia 13: 329–333.
CCDB · ipcn-api-dl — Baltisberger, M. 1981. Verwandtschaftsbeziehungen zwischen der Gruppe des Ranunculus polyanthemos L. und R. repens L. sowie arten der Gruppen des R. acris L. und des R. bulbosus L. Bot. Helv. 91: 61–74.
CCDB · ipcn-api-dl — KAPOOR, B. M. 1981. Karyomorphological studies in some species of Ranunculus. Phyton 41: 153–164.
CCDB · ipcn-api-dl — Agapova, N. D. & E. A. Zemskova. 1985. Chromosome numbers in some species of the genus Ranunculus (Ranunculaceae). Bot. Zhurn. SSSR 70(6): 855–856.
CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.
CCDB · ipcn-api-dl — Stepanov, N. V. & E. N. Muratova. 1995. Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žhurn. (Moscow & Leningrad) 80(6): 114–116.
CCDB · ipcn-api-dl — Baltisberger, M. & E. Baltisberger. 1995. Cytological data of Albanian plants. Candollea 50(2): 457–493.
CCDB · ipcn-api-dl — Murin, A. & L. PACLOVA. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 403–405.
CCDB · ipcn-api-dl — Agapova, N. D. 1980b. In Chromosome number reports LXIX. Taxon 29:703.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — GERVAIS, C. 1981. Liste annotee de nombres chromosomiques de la flore vasculaire du nord-est de l'Amerique. II. Naturaliste Canad. 108: 143–152.
CCDB · ipcn-api-dl — Murín, A. & L. Paclová. 2002. Ranunculus altitatrensis---the tetraploid species from the complex of R. acris in the flora of the Vysoké Tatry Mts. Biologia (Bratislava) 57: 69–74.
CCDB · ipcn-api-dl — Baltisberger. 2006. Cytological investigations on Bulgarian phanerogams. Willdenowia 36(Special Issue): 205–216.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Buttler, K. P. 1985. Chromosomenzahlen von Gefässpflanzen aus Hessen (und angrenzenden Ländern), 3. Folge. Hess. Florist. Briefe 34: 37–42.
CCDB · ipcn-api-dl — Baltisberger, M. & W. Huber. 1987. Chromosome number report. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 9: 4–5.
+77 more references
2n 3222×CCDB · ita-fl · CCDB · new-zealand · CCDB · fl-europaea +6
CCDB · ita-fl — MARCHI P., CAPINERI R., D'AMATO G. - 1975. Numeri cromosomici per la flora italiana:208-218.. Inform. Bot. Ital. , 7(3): 377-389.
CCDB · ita-fl — GIORDANI A., MICELI P., MONTI G. - 1980. Numeri cromosomici per la flora italiana:789-793.. Inform. Bot. Ital. , 12(3): 327-332.
CCDB · ita-fl — MASCI S.M., MARCHI P., VISONA L. - 1987. Numeri cromosomici per la flora italiana: 1098-1105.. Inform. Bot. Ital. , 19(2): 167-172.
CCDB · new-zealand
CCDB · fl-europaea — Landolt, 1954
CCDB · ipcn-api-dl — Masci, S. M., P. Marchi & L. Visoná. 1987. Numeri cromosomici per la flora Italiana: 1098--1105. Inform. Bot. Ital. 19: 167–172.
CCDB · ipcn-api-dl — Dickenmann, R. 1982. Genetisch-ökologische Untersuchungen an Ranunculus montanus Willd. s.l. aus der alpinen Stufe von Davos (Graubünden). Veröff. Geobot. Inst. ETH Stiftung Rübel Zürich 78: 1–89.
CCDB · ipcn-api-dl — Micelli, P. & G. Monti. 1980. Numeri cromosomici per la Flora Italiana: 787-793. Inform. Bot. Ital. 12: 327–332.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn75-78 — Marchi et al. 1975
CCDB · book-ipcn73-74 — GOEPFERT, D. 1974. Karyotypes and DNA content in species of Ranunculus L. and related genera. Bot. Notiser 127: 464-489.
CCDB · kew — Goepfert D. 1974. Karyotypes and DNA content in species of Ranunculus L. and related genera. Botaniska Notiser 127: 464-489.
CCDB · CromoCat 2015 — Baltisberger, M. (1984). Zytologische Untersuchungen an einigen Pflanzen aus Albanien Berichte des Geobotanishen Institutes der Eidgenössische Technishe Hochschule Stiftung Rübel 51: 63-77
CCDB · CromoCat 2015 — Baltisberger, M. (1990b). Chromosomenzahlen einiger Pflanzen aus Jugoslawien. Candollea 45: 439-446.
CCDB · CromoCat 2015 — Baltisberger, M. (1992). Botanische Notizen und zytologische Untersuchungen an einigen Pflanzen (insbesondere aus den Gattungen Ranunculus und Achillea) aus dem albanisch-jugoslawischen Grenzgebiet (Korab, Sar Planina). Ber. Geobot. Inst. E.T.H. Stiftung
CCDB · CromoCat 2015 — Dickenmann, R. (1982). Genetisch-ökologische Untersuchungen an Ranunculus montanus Willd. s.l. aus der alpinen Stufe von Davos (Graubünden) Veröffentlichungen der Geobotanischen Institutes der ETH, Stiftung Rübel, Zürich 78: 1-89
CCDB · CromoCat 2015 — Giordani, A. , Micelli, P. & Monti, G. (1980). Numeri cromosomici per la Flora Italiana: 787-793. Informatore Botanico Italiano 12: 327-332.
CCDB · CromoCat 2015 — Lippert, W. (2006). Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten Ber. Bayer. Bot. Ges. 76: 85–110
CCDB · CromoCat 2015 — Lovka, M., Susnik, F., Löve, A. & Löve, D. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIV]. Taxon 20(5/6): 788-791.
CCDB · CromoCat 2015 — Masci, S. M., Marchi, P. & Visoná, L. (1987). Numeri cromosomici per la flora Italiana: 1098--1105 Informatore Botanico Italiano 19: 167-172
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
2n 1617×CCDB · poland · CCDB · mediterranean · CCDB · ipcn-api-dl +4
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · mediterranean
CCDB · ipcn-api-dl — Baltisberger, M. 1984. Zytologische Untersuchungen an einigen Pflanzen aus Albanien. Ber. Geobot. Inst. ETH Stiftung Rübel 51: 63–77.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Baltisberger. 2006. Cytological investigations on Bulgarian phanerogams. Willdenowia 36(Special Issue): 205–216.
CCDB · book-ipcn72 — ROY, S.C., & A.K. SHARMA. 1971. Cytotaxonomic studies on Indian Ranunculaceae. Nucleus 14: 132-143.
CCDB · book-fedorov — Hocquette 1922
CCDB · Cave1959 — Skalinska et al. 1959
CCDB · CromoCat 2015 — Baltisberger, M. (1984). Zytologische Untersuchungen an einigen Pflanzen aus Albanien Berichte des Geobotanishen Institutes der Eidgenössische Technishe Hochschule Stiftung Rübel 51: 63-77
CCDB · CromoCat 2015 — Baltisberger, M. (1990b). Chromosomenzahlen einiger Pflanzen aus Jugoslawien. Candollea 45: 439-446.
CCDB · CromoCat 2015 — Baltisberger, M. (1992). Botanische Notizen und zytologische Untersuchungen an einigen Pflanzen (insbesondere aus den Gattungen Ranunculus und Achillea) aus dem albanisch-jugoslawischen Grenzgebiet (Korab, Sar Planina). Ber. Geobot. Inst. E.T.H. Stiftung
CCDB · CromoCat 2015 — Baltisberger, M. (2002). Cytological investigations on some Albanian plant species Candollea 56: 245-259
CCDB · CromoCat 2015 — Baltisberger, M. (2006). Cytological investigations on Bulgarian phanerogams Willdenowia 36: 205-216
CCDB · CromoCat 2015 — Cheshmedziev, I. V. (1994). Reports (313-366). Fl. Medit. 4: 269-279.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
CCDB · CromoCat 2015 — Goepfert, D. (1974). Karyotypes and DNA content in species of Ranunculus L. and related genera. Bot. Not. 127: 464-489.
CCDB · CromoCat 2015 — Sopova, M. & Sekovski, Z. (1982). Chromosome atlas of some Macedonian angiosperms Skopje
2n 2812×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +4
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Murín A. & Paclová L., 1979: [Report], pp. 403-405. - In: Löve Á. (ed.), IOPB Chromosome number reports LXIV, Taxon 28 /4.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · ipcn-api-dl — Malacha, E. V. 1989. Karyosistematicheskij obsor roda Ranunculus vo flore Sovetskogo dalnego vostoka. Pp. 55--56 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Malakha, E. V. 1990. Chromosome numbers in some species of the genera Ranunculus and Batrachium (Ranunculaceae) from the flora of the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 75: 121–122.
CCDB · book-ipcn67-71 — KURITA, M. 1961. Chromosome studies in Ranunculaceae XVIII. Karyotypes of several species. Mem. Ehime Univ. Sect. II (Sci.) Ser. B (Biol.), Q(2): 251-261.
CCDB · book-fedorov — Sakai K. 1935a
CCDB · CromoCat 2015 — Lavrenko, A. N. & Serditov, N. P. (1985). Karyosystematic study of the representatives of the families Ranunculaceae and Paeoniaceae in the North-East of the European part of the U.S.S.R. Bot. Žurn. 70: 1346-1354.
CCDB · CromoCat 2015 — Malakha, E.V. (1990). Chromosome numbers in some species of the genera Ranunculus and Batrachium (Ranunculaceae) from the flora of the Soviet far east Botani?eskij Žurnal (Moscow & Leningrad) 75: 121-122
CCDB · CromoCat 2015 — Malakha, E.V. (1990). Chromosome numbers in some species of the genera Ranunculus and Batrachium (Ranunculaceae) from the flora of the Soviet far east. Bot. Zurn. 75:121-122
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
2n 487×CCDB · new-zealand · CCDB · ipcn-api-dl
CCDB · new-zealand
CCDB · ipcn-api-dl — de Lange, P. J., B. G. Murray & P. M. Datson. 2004. Contributions to a chromosome atlas of the New Zealand flora---38. Counts for 50 families. New Zealand J. Bot. 42: 873–904.
CCDB · ipcn-api-dl — Dawson, M. I. & E. J. Beuzenberg. 2000. Contributions to a chromosome atlas of the New Zealand flora. New Zealand J. Bot. 38: 1–24.
2n 121×CCDB · book-fedorov
CCDB · book-fedorov — Sorokin 1924
2n 211×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Trahan, R. (2002). Documentation chromosomique. Contribution no. 5 Ludoviciana 30: 64–66
2n 241×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Mattick, R. 2002. In C. Dobea & W. Gutermann, Nachträge und Revisionen zu Renate Matticks Chromosomenzählungen in Tischler 1950. Linzer Biol. Beitr. 34(2): 1071–1083.
2n 401×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
n 711×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1963 +1
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Agapova, N. D. 1980b. In Chromosome number reports LXIX. Taxon 29:703.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Diosdado, J. C. & J. E. Pastor. 1992. Citotaxonomĭa de la especies vivaces del Gĕnero Ranunculus L. sect. Chrysanthe (Spach) L. Benson en la Penĭnsula Ibĕrica. Candollea 47(2): 555–576.
CCDB · ipcn-api-dl — Diosdado, J. C. & J. E. Pastor. 1996. Consideraciones citotaxonómicas del género Ranunculus L. (Ranunculaceae) en la Península Ibérica. Anales Jard. Bot. Madrid 54: 166–178.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Agapova, N. D. (1980a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 703.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
n 81×CCDB · ita-fl
CCDB · ita-fl — ZICKLER D. - 1967. Orophytes.. Caryosystematique et Cytogenetique , 1: 7/10/2000.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time3.6–0.01 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range3.6–0.01 Ma Pliocene, Pleistocene
Dated fossil finds4
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Ranunculus acris. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type1 018 636 records
Wild obs. + sensor987 404
Museum / vouchered24 567
Cultivated / captive1 557
Fossil4
Other5 104
Origin
Native46 470
Introduced56
Range
Area of Occupancy AOO759 324 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 175 808≤1 km 213 222≤10 km 392 863>10 km 5 162
787 055 georeferenced · 200 349 without coordinates
Open the mapobservation + sensor987 404
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 1 954≤1 km 4 798≤10 km 10 992>10 km 1 350
19 094 georeferenced · 5 473 without coordinates
Open the institutions mapphysical evidence24 567
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4>10 km 13
17 georeferenced · 1 540 without coordinates
Open the mapnot free-living1 557
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions160 of 306 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 11 575 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 627 |
| Helsinki, FI | 975 |
| LDlocation not on record | 527 |
| Moscow State Universitylocation not on record | 434 |
| Tallinn, EE | 402 |
| Chongqing Museumlocation not on record | 314 |
| Philadelphia, US | 278 |
| Oulu, FI | 275 |
| Madison, US | 227 |
| MeiseBGlocation not on record | 213 |
| Tartu, EE | 187 |
| Québec, CA | 184 |
| Uniwersytet Warszawskilocation not on record | 169 |
| Oskarshamn, SE | 167 |
| 164 | |
| Jyväskylä, FI | 154 |
| Garðabær, IS | 148 |
| Tsukuba, JP | 144 |
| Salzburg, AT | 140 |
| BFLlocation not on record | 130 |
| Bergen, NO | 124 |
| Université Lavallocation not on record | 117 |
| KMNlocation not on record | 117 |
| South Kensington, GB | 109 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 101 |
| Uniwersytet Śląski w Katowicachlocation not on record | 100 |
| Görlitz, DE | 99 |
| Acadia Universitylocation not on record | 94 |
| St. Paul, US | 92 |
| Ann Arbor, US | 91 |
| Bronx, US | 87 |
| Olocation not on record | 87 |
| University of Alberta Museumslocation not on record | 85 |
| Saint John, CA | 85 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 83 |
| Museo Entomologico de Leonlocation not on record | 76 |
| University of New Hampshirelocation not on record | 74 |
| Montréal, CA | 69 |
| Burlington, US | 68 |
| Uniwersytet Jagiellońskilocation not on record | 66 |
| Berlin, DE | 61 |
| BRNUlocation not on record | 59 |
| Green Bay, US | 58 |
| Zürich, CH | 57 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 57 |
| Mlocation not on record | 57 |
| Victoria, CA | 56 |
| SLU Artdatabankenlocation not on record | 55 |
| Tampere, FI | 50 |
| Guangzhou, CN | 49 |
| Allentown, US | 48 |
| WTUlocation not on record | 46 |
| Kuopio, FI | 46 |
| Vitebsk State University named after P.M. Masherovlocation not on record | 46 |
| BDBClocation not on record | 45 |
| Karlsruhe, DE | 45 |
| Zürich, CH | 43 |
| Uppsala, SE | 43 |
| Toronto, CA | 38 |
| Provincia di Livornolocation not on record | 38 |
| Auckland, NZ | 36 |
| TROMlocation not on record | 35 |
| New Haven, US | 35 |
| Turku, FI | 34 |
| TUR-Alocation not on record | 33 |
| UGentlocation not on record | 32 |
| Trondheim, NO | 32 |
| Christchurch, NZ | 30 |
| Wlocation not on record | 30 |
| Uniwersytet Opolskilocation not on record | 30 |
| Kandalaksha State Nature Reservelocation not on record | 29 |
| Pullman, US | 28 |
| Corvallis, US | 27 |
| Moscow, US | 26 |
| Natural History Museum Rotterdamlocation not on record | 26 |
| Entomological Society of Latvialocation not on record | 25 |
| BClocation not on record | 25 |
| BIO-UNIPIlocation not on record | 24 |
| Bern, CH | 24 |
| Bloomington, US | 24 |
| Missoula, US | 23 |
| Porvoo, FI | 22 |
| Frankfurt am Main | 22 |
| Adam Mickiewicz University in Poznańlocation not on record | 22 |
| GJOlocation not on record | 21 |
| València, ES | 20 |
| Vancouver, CA | 20 |
| Wellington, NZ | 20 |
| Whitewater, US | 19 |
| Paris, FR | 19 |
| College Park, US | 19 |
| University of Stellenboschlocation not on record | 18 |
| Keene State Universitylocation not on record | 17 |
| University of Lethbridgelocation not on record | 17 |
| Bozeman, US | 17 |
| WINlocation not on record | 16 |
| Chapel Hill, US | 14 |
| Philadelphia, US | 13 |
| Beijing, CN | 12 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 12 |
| Tula State Universitylocation not on record | 12 |
| Vitoria, ES | 12 |
| Millersville, US | 11 |
| Rovaniemi, FI | 11 |
| Staten Island, US | 11 |
| University of Wisconsinlocation not on record | 11 |
| Denver, US | 10 |
| GZUlocation not on record | 10 |
| SZUlocation not on record | 10 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 10 |
| Bourges, FR | 10 |
| Trois-Rivières, CA | 10 |
| MAlocation not on record | 10 |
| Flagstaff, US | 9 |
| Dekalb, US | 9 |
| Boise, US | 9 |
| DBF-NHMDlocation not on record | 9 |
| Tampa, US | 8 |
| Anchorage, US | 8 |
| Barcelona, ES | 8 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Dresden, DE | 7 |
| Portland, US | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 7 |
| Philadelphia, US | 7 |
| Xiamen, CN | 7 |
| Wuzhou, CN | 7 |
| Tilburg, NL | 7 |
| Miami, US | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Royal Botanical Gardenslocation not on record | 6 |
| Hudson, US | 6 |
| NMBU:MINAlocation not on record | 6 |
| Emporia, US | 6 |
| Davenport, US | 6 |
| Williamsburg, US | 6 |
| BSBIlocation not on record | 6 |
| nbflocation not on record | 6 |
| Pamplona, ES | 6 |
| Institute of the biological problems of the North FEB RASlocation not on record | 6 |
| Provo, US | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 5 |
| Mohonk Preservelocation not on record | 5 |
| Whitehorse, CA | 5 |
| BG-NMNHSlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Porrentruy, CH | 5 |
| Fulda, DE | 5 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| Rotorua, NZ | 5 |
| *unvoucheredlocation not on record | 5 |
| PRClocation not on record | 5 |
| Durham, US | 5 |
| OLAlocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Brookings, US | 4 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Kingston, US | 4 |
| Saint Louis, US | 4 |
| Chicago, US | 4 |
| EL PASO, US | 4 |
| CICYTEXlocation not on record | 4 |
| Logan, US | 4 |
| Spearfish, US | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Göteborg, SE | 4 |
| CJBGlocation not on record | 4 |
| Herb. BBGlocation not on record | 4 |
| Kew, GB | 3 |
| Monastir, TN | 3 |
| Asheville, US | 3 |
| Tuscaloosa, US | 3 |
| Hobart, AU | 3 |
| Norfolk, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Chadron, US | 3 |
| Xian, CN | 3 |
| Claremont, US | 3 |
| Salamanca, ES | 3 |
| Universidad de La Salle (La Salle)location not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Pocatello, US | 3 |
| New Brunswick, US | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Stockholm, SE | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Riverside, US | 3 |
| Guilin, CN | 3 |
| Washington, US | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| Kushiro City Museumlocation not on record | 3 |
| LfUlocation not on record | 3 |
| Pittsburg, US | 3 |
| Portland, US | 2 |
| Xining, CN | 2 |
| Ivano-Frankove, UA | 2 |
| Longwood Universitylocation not on record | 2 |
| USFS/BHSClocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Columbia, US | 2 |
| Phoenix, US | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Podgorica, ME | 2 |
| Mississippi State, US | 2 |
| AASlocation not on record | 2 |
| Namur, BE | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Hamilton, US | 2 |
| IDElocation not on record | 2 |
| Ypsilanti, US | 2 |
| Madrid, ES | 2 |
| ASUlocation not on record | 2 |
| Sion, CH | 2 |
| Mount Annan, AU | 2 |
| Uniwersytet w Białymstokulocation not on record | 2 |
| Guangzhou, CN | 2 |
| Mount Pleasant, US | 2 |
| Montréal, CA | 2 |
| DASSHlocation not on record | 2 |
| US | 2 |
| Forssa, FI | 2 |
| National Botanic Garden of Waleslocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Peking Universitylocation not on record | 2 |
| Johnson City, US | 2 |
| The Manitoba Museum, Botany Departmentlocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| UFPRlocation not on record | 2 |
| Tacoma, US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| FLADlocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| CASlocation not on record | 2 |
| Canberra, AU | 2 |
| Changsha, CN | 1 |
| Western Carolina Universitylocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Badajoz, ES | 1 |
| Alicante, ES | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Boumlocation not on record | 1 |
| San Diego, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| Springfield, US | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Adelaide, AU | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Bangkok, TH | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| Macomb, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Portland, US | 1 |
| Jackson, US | 1 |
| Nijmegen, NL | 1 |
| Turlock, US | 1 |
| Dover, US | 1 |
| San Luis Obispo, US | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Fullerton, US | 1 |
| Metsähallituslocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| POL003location not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Awka, NG | 1 |
| Long Beach, US | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Richmond, US | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Knoxville, US | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Chicago, US | 1 |
| Dhaka, BD | 1 |
| Sant Julià de Lòria, AD | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Oswego, US | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Fredericksburg, US | 1 |
| Edinburgh, GB | 1 |
| Palmerston North, NZ | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
306 institutions · 22 906 of 24 567 vouchered records shown · 1 234 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA39 detections
Where the DNA of Ranunculus acris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found39
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 39 detections have coordinates
Open the map9 countries0
Coastal Shrub with 10% goose damageManaged boreal mixedwood standGrowing in meadow surrounding cabinunder trees.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.5 °C 10.3–18.6
Seasonal swing summer↔winter14.9 °C
Max temp (day)17.2 °C 13.0–23.6
Min temp (night)9.50 °C 6.50–14.2
Precipitation79.2 mm/mo 52.3–93.9
Air humidity61.1 % 57.1–62.9
Moisture balance-33.1 mm/mo
Vapour deficit596 Pa 490–916
Wind speed3.90 m/s
Cloud cover45.4 % 38.6–50.8
CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.