Ramularia rubella

(Bonord.) Nannf. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Mycosphaerellales/Mycosphaerellaceae/Ramularia

At a glance

Occurrence records4 652

Data sources8

Biological traits0

DNA specimens0

eDNA detections3

Sources8 archives

Databases and archives Ramularia rubella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 652 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 652 records

Environmental DNA3 datasets · 1 countries3 detections

DNA & barcodingNCBIsequences

01Narrative

Ramularia rubella is a plant pathogen in Ascomycota that infects Rumex species. Infection produces reddish spots on leaves. The red color is caused by the production of rubellin, a photodynamic anthraquinone-derived phytotoxin. R. rubella was originally described from Rumex aquaticus in Germany; it has a wide geographic range on Rumex species. It is being investigated as a biological control agent of Rumex obtusifolius.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ramularia rubella has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

eDNA detections3

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMT586828.1 ↗631 bpUSA

ACGT

TCGCTACTACCGATTGAATGGCTCAGTGAGGCCTTCGGACTGGCCCAGGGAGGTCGGCAACGACCACCCAGGGCCGGAAAGTTGGTCAAA …

Ramularia rubella strain DW16-01 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type4 652 records

Wild obs. + sensor4 326

Museum / vouchered325

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO10 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy49% within 1 km

≤100 m 1 315≤1 km 566≤10 km 1 921>10 km 40

3 842 georeferenced · 484 without coordinates

Open the mapobservation + sensor4 326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy49% within 1 km

≤100 m 2≤1 km 34≤10 km 11>10 km 27

74 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence325

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	139
Helsinki, FI	41
DPIlocation not on record	29
WU-MYClocation not on record	20
TROMlocation not on record	18
Auckland, NZ	15
Tartu, EE	12
Karlsruhe, DE	8
Kew, GB	7
LDlocation not on record	5
Uppsala, SE	4
Pullman, US	3
McWane Science Centerlocation not on record	3
Bronx, US	2
Museo Entomologico de Leonlocation not on record	2
Oulu, FI	2
Bernard Price Institute for Palaeontological Researchlocation not on record	2
CA	1
GJOlocation not on record	1
PRClocation not on record	1
Madison, US	1
	1

22 institutions · 317 of 325 vouchered records shown · 8 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Ramularia rubella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys3

Countries1

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.10 °C 9.10–9.10

Seasonal swing summer↔winter19.2 °C

Max temp (day)13.2 °C

Min temp (night)2.70 °C

Precipitation160 mm/mo

Air humidity60.6 %

Moisture balance34.3 mm/mo

Vapour deficit455 Pa

Wind speed7.10 m/s

Cloud cover33.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ramularia rubella

At a glance

Sources8 archives

At a glance

Record type4 652 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 652 records