Ramonda serbica

Pancic · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Gesneriaceae/Ramonda

At a glance

Occurrence records148

Data sources10

Biological traits6

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Ramonda serbica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility148 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF148 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT3.9 Gbp

01Narrative

Рамо́нда сербская, или феникс — цветковое растение семейства геснериевых. Открыл её сербский ботаник Йосиф Панчич в 1874 году в окрестностях города Ниш. Сербская рамонда — эндемик Центральных Балкан и, по всей видимости, представляет собой остаток субтропической флоры Европы и Средиземноморья африканского происхождения.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formlithophyte

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ramonda serbica has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP773239.1 ↗603 bpGreece

ACGT

ATAGACCCGTGAACAAGTTTATTTTTCAATCGTGATGTTGGAGCCTTTGTGCCCAACATCACGACCTTGACCCCAAGCGGTGCAAGTCGG …

Ramonda serbica voucher cult. RBGE 19871128 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Ramonda serbica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 942 327 979 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Ramonda serbica3.94 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 144 n = 72

Ploidy6× / 8× cytotypes

Chromosome records72–1922n range144median144mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1443×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Siljak-Yakovlev S, Stevanovic V, Tomasevic M, Brown SC, Stevanovic B. 2008. Genome size variation and polyploidy in the resurrection plant genus Ramonda: Cytogeography of living fossils. Environmental and Experimental Botany 62: 101-112.

2n 1922×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

2n 721×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type148 records

Wild obs. + sensor141

Museum / vouchered6

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 70≤1 km 29≤10 km 13>10 km 2

114 georeferenced · 27 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence6

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wlocation not on record	2
GJOlocation not on record	1
BRNUlocation not on record	1
Berlin, DE	1
M-VascularPlantslocation not on record	1

5 institutions · 6 of 6 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Ramonda serbica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)