Ramaria araiospora

Marr & D.E.Stuntz · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Gomphales/Gomphaceae/Ramaria

At a glance

Occurrence records639

Data sources8

Biological traits0

DNA specimens16

eDNA detections15

Sources8 archives

Databases and archives Ramaria araiospora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility639 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF639 records

Environmental DNA1 datasets · 1 countries15 detections

DNA & barcodingBOLD · NCBI16 specimens

01Narrative

Ramaria araiospora, commonly known as the red coral, is a coral mushroom in the family Gomphaceae. First described in 1974, it is found in North America, and the Himalaya. An edible species, it is sold in local markets in Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ramaria araiospora has left across the world's sequence archives.

At a glance

DNA specimens16

Marker genes2

GenBank sequences10

eDNA detections15

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ354488.1 ↗315 bpUSA · 1956

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAACTCTCTCAACCCTTTTACTCCTTTGTTGGAGAA …

Ramaria araiospora clone 4530 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type639 records

Wild obs. + sensor581

Museum / vouchered58

Range

Area of Occupancy AOO1 556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 269≤1 km 87≤10 km 63>10 km 79

498 georeferenced · 83 without coordinates

Open the mapobservation + sensor581

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 2≤1 km 13≤10 km 15>10 km 1

31 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence58

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	23
Vancouver, CA	5
California State University, East Baylocation not on record	5
Private Collection of Steve Nesslocation not on record	4
TENN-Flocation not on record	4
Davis and Elkins Collegelocation not on record	3
Bernard Price Institute for Palaeontological Researchlocation not on record	2
National Mushroom Centre, Department of Agriculture, Ministry of Agriculture and Livestock, Bhutanlocation not on record	1
Durham, US	1
Catholic University of Pekinglocation not on record	1
ILLSlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

13 institutions · 52 of 58 vouchered records shown · 6 without an institution code

09Environmental DNA15 detections

Where the DNA of Ramaria araiospora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map1 country0

ForestOld Growth Doug fir

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 7.20–14.1

Seasonal swing summer↔winter9.00 °C

Max temp (day)14.8 °C 10.0–17.1

Min temp (night)8.20 °C 4.60–12.0

Precipitation190 mm/mo 56.0–242

Air humidity66.2 % 65.3–69.6

Moisture balance201 mm/mo

Vapour deficit449 Pa 311–545

Wind speed2.80 m/s

Cloud cover50.2 % 36.5–53.3

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)