Ramaria acrisiccescens

Marr & D.E.Stuntz · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Gomphales/Gomphaceae/Ramaria

At a glance

Occurrence records139

Data sources8

Biological traits0

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Ramaria acrisiccescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Ramaria acrisiccescens, commonly known as the blah coral, is a coral fungus in the family Gomphaceae. It is found in the forests of northwestern North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ramaria acrisiccescens has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ354486.1 ↗203 bpUSA · 1956

ACGT

GAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAATAAAATCTCACCCTTGCCTGTCGCTCAGTGCTC …

Ramaria acrisiccescens clone 4528 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor53

Museum / vouchered86

Range

Area of Occupancy AOO396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 19≤1 km 8≤10 km 5>10 km 9

41 georeferenced · 12 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤1 km 8≤10 km 41>10 km 1

50 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WTUlocation not on record	44
TENN-Flocation not on record	11
Denver, US	10
Vancouver, CA	8
St. Paul, US	2
ILLSlocation not on record	2
Ann Arbor, US	1
Chicago, US	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
California State University, East Baylocation not on record	1

10 institutions · 81 of 86 vouchered records shown · 5 without an institution code

09Environmental DNA4 detections

Where the DNA of Ramaria acrisiccescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 11.9–12.0

Seasonal swing summer↔winter8.70 °C

Max temp (day)15.2 °C 14.8–15.6

Min temp (night)9.00 °C 8.60–9.40

Precipitation178 mm/mo 168–188

Air humidity67.1 % 66.4–67.8

Moisture balance136 mm/mo 128–144

Vapour deficit459 Pa 447–471

Wind speed1.70 m/s 1.50–1.90

Cloud cover54.6 % 52.4–56.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)