Ramalina celastri

(Spreng.) A.Massal. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Ramalinaceae/Ramalina

At a glance

Occurrence records2 536

Data sources6

Biological traits0

DNA specimens3

eDNA detections5

Sources6 archives

Databases and archives Ramalina celastri's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 536 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 536 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ramalina celastri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences10

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMN954782.1 ↗461 bpUSA

ACGT

GATCATTACAGAGAGGGGCCTGCGCCCCAGGGGACTCCGGTCCCCGCCTCTTCACCCCGTGATTTCCGTTACCGTTGTTTTGGCGGGACC …

Ramalina celastri isolate s6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type2 536 records

Wild obs. + sensor1 902

Museum / vouchered634

Range

Area of Occupancy AOO6 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 112≤1 km 230≤10 km 59>10 km 68

1 469 georeferenced · 433 without coordinates

Open the mapobservation + sensor1 902

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤1 km 11≤10 km 4>10 km 2

17 georeferenced · 617 without coordinates

Open the institutions mapphysical evidence634

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	274
Pretoria, ZA	89
LDlocation not on record	89
Uppsala, SE	26
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	23
St. Paul, US	18
Göteborg, SE	16
Berlin, DE	14
McWane Science Centerlocation not on record	14
Wuzhou, CN	12
Wellington, NZ	12
Christchurch, NZ	6
University of Gdansklocation not on record	5
Rotorua, NZ	4
Helsinki, FI	4
EL PASO, US	1
Pontificia Universidad Javeriana (PUJ)location not on record	1
South Kensington, GB	1
Lake Charles, US	1
Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record	1
AADClocation not on record	1

21 institutions · 612 of 634 vouchered records shown · 19 without an institution code

09Environmental DNA5 detections

Where the DNA of Ramalina celastri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 8.00–12.8

Seasonal swing summer↔winter7.80 °C

Max temp (day)13.9 °C 11.7–14.6

Min temp (night)10.2 °C 4.30–10.7

Precipitation113 mm/mo 61.1–133

Air humidity62.5 % 60.6–64.6

Moisture balance32.8 mm/mo -8.30–57.6

Vapour deficit530 Pa 397–550

Wind speed4.80 m/s 4.60–4.80

Cloud cover29.9 % 29.0–34.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ramalina celastri

At a glance

Sources6 archives

At a glance

Record type2 536 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 536 records