Ramalina americana

Hale · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Ramalinaceae/Ramalina

At a glance

Occurrence records2 353

Data sources10

Biological traits1

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Ramalina americana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 353 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF2 353 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈25 Mbp

01Narrative

Ramalina americana, commonly known as the sinewed ramalina, is a pale green fruticose lichen that is found across the Northern US Midwest, extending into Southern Canada and the Eastern Seaboard. It is characterized morphologically by the presence of pseudocyphellae, straight spores, and its unique chemical diversity.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

03Chemical composition5 compounds

Compounds documented for Ramalina americana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavandiols (Leucoanthocyanidins)3

Flavanones1

Depsides1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4S,5S,6R)-2-[[(2R,3R,4S)-3,7-dihydroxy-2-(4-hydroxyphenyl)-5-methoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-4-yl]oxy]-6-[[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[[(2R,3S,4S)-3,4-dihydroxy-2-(4-hydroxyphenyl)-5-methoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-7-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2S,3R,4S,5S,6R)-2-[[(2R,3S,4S)-3-hydroxy-2-(4-hydroxyphenyl)-4,5-dimethoxy-8-(3-methylbut-2-enyl)-3,4-dihydro-2H-chromen-7-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
Sophoraflavanone B	present	NPASS
Trivaric acid	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ramalina americana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ003100.1 ↗207 bp

ACGT

GGCTGTCACCAGCCTACGACGTTTGCGGAACCTGCGGAAGGATCATTAAAGAGAGGGGCTTCGCGCTCCAGGGGACTTCGGTCCCCGCCT …

Ramalina americana strain Normore4358 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ramalina americana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈24 548 484 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Ramalina americana0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type2 353 records

Wild obs. + sensor795

Museum / vouchered1 558

Range

Area of Occupancy AOO7 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 410≤1 km 71≤10 km 31>10 km 104

616 georeferenced · 179 without coordinates

Open the mapobservation + sensor795

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 15≤1 km 113≤10 km 197>10 km 41

366 georeferenced · 1 192 without coordinates

Open the institutions mapphysical evidence1 558

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	411
Madison, US	313
Bronx, US	199
Wuzhou, CN	106
Durham, US	95
ILLSlocation not on record	74
US	53
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	36
University of Stellenboschlocation not on record	32
Oregon State Universitylocation not on record	23
Ann Arbor, US	21
Chicago, US	21
AUAlocation not on record	18
FLASlocation not on record	16
PHlocation not on record	15
Université Lavallocation not on record	12
Chapel Hill, US	12
Museum of the Rockieslocation not on record	10
Catholic University of Pekinglocation not on record	8
DOI/NPS, Colonial National Historical Parklocation not on record	8
ASUlocation not on record	8
Boise, US	5
Champaign, US	5
Minia, EG	5
EL PASO, US	4
Vancouver, CA	4
University of Manitobalocation not on record	4
Bergen, NO	3
NYSlocation not on record	3
South Kensington, GB	3
Uppsala, SE	3
Toronto, CA	3
Fort Worth, US	2
Clarksville, US	2
UFMSlocation not on record	2
Helsinki, FI	2
Portland, US	2
University of Western Ontariolocation not on record	1
New Brunswick, US	1
McWane Science Centerlocation not on record	1
University of Gdansklocation not on record	1
Bozeman, US	1
Santa Barbara, US	1
Philadelphia, US	1
WTUlocation not on record	1
Fort Hayslocation not on record	1
Morgantown, US	1
Butler Universitylocation not on record	1
LDlocation not on record	1

49 institutions · 1 555 of 1 558 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Ramalina americana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ramalina americana

At a glance

Sources10 archives

Habitat & environment1

Compound class profile3 classes

Documented compounds5 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 353 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 49 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 353 records