Quercus lusitanica

Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fagales/Fagaceae/Quercus

At a glance

Occurrence records2 557

Data sources12

Biological traits21

DNA specimens3

eDNA detections3

Sources12 archives

Databases and archives Quercus lusitanica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 557 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS · NPASS63 compounds

Occurrence & distributionGBIF2 557 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Quercus lusitanica is een bladverliezende soort eik die voorkomt in Spanje, Portugal en Marokko. De Spaanse naam is roble de tintoreros. In het Engels wordt ze vaak Gall Oak genoemd. De gallen zijn afkomstig van de eikengalwesp Cynips gallae

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height10 m

Seed mass8 058 mg

Seed mass max8 117 mg

Seed mass min8 000 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Dispersal typeanimal

Life formshrub

Life span> 150

⚠ sources differ — TRY: > 150 · GIFT: perennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation mean348 m

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

Physiology & chemistry4

Leaf n14.4 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)7.18 mm²/mg

Wood density700 mg/cm³

03Chemical composition63 compounds

Compounds documented for Quercus lusitanica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Verticillane diterpenoids42

Gallotannins2

Cholestane steroids2

Xenicane diterpenoids1

Simple phenolic acids1

Documented compounds63 total

Tissue Source Quantified only

Compound	Amount	Source
(1aR,3S,4aS,7S,8aS)-7-hydroxy-3-[(1S,2R,3R)-2-(2-hydroxyethyl)-2-methyl-3-[(1S)-1-[(1R,2R)-2-methyl-2-[(2R)-3-methylbutan-2-yl]cyclopropyl]ethyl]cyclopentyl]-4a-methyl-2,3,5,6,7,8-hexahydro-1aH-naphtho[4,4a-b]oxiren-4-one	present	NPASS
(1aR,3S,4aS,7S,8aS)-7-hydroxy-3-[(1S,2R,3R)-2-(2-hydroxyethyl)-2-methyl-3-[(2R)-6-methylheptan-2-yl]cyclopentyl]-4a-methyl-2,3,5,6,7,8-hexahydro-1aH-naphtho[4,4a-b]oxiren-4-one	present	NPASS
(1R,2R,4S,6E,8R,13S,15S)-2-methoxy-6,14,14-trimethyl-10-methylidene-3,16-dioxatetracyclo[11.3.2.01,15.04,15]octadec-6-ene-4,8-diol	present	NPASS
(1R,2S,4S,6E,8R,13S,15S)-2-methoxy-6,14,14-trimethyl-10-methylidene-3,16-dioxatetracyclo[11.3.2.01,15.04,15]octadec-6-ene-4,8-diol	present	NPASS
(1R,3E,10R)-3,17,17-trimethyl-7-methylidene-15-oxatricyclo[8.5.2.013,16]heptadeca-3,13(16)-dien-14-one	present	NPASS
(1R,3E,5R,10R)-1,5-dihydroxy-3,17,17-trimethyl-7-methylidene-15-oxatricyclo[8.5.2.013,16]heptadeca-3,13(16)-dien-14-one	present	NPASS
(1R,3S,7Z,10S)-1-hydroxy-3,7,17,17-tetramethyl-15-oxatricyclo[8.5.2.013,16]heptadeca-7,13(16)-diene-5,14-dione	present	NPASS
(1R,4E,6S,11R)-1,6-dihydroxy-4,15,15-trimethyl-8-methylidenebicyclo[9.3.1]pentadec-4-ene-2,14-dione	present	NPASS
(1R,5E,7S,12R)-7-hydroxy-5,16,16-trimethyl-9-methylidene-2-oxabicyclo[10.3.1]hexadec-5-ene-3,15-dione	present	NPASS
(1S,3E,10S)-3,17,17-trimethyl-7-methylidene-15-oxatricyclo[8.5.2.013,16]heptadeca-3,13(16)-diene-5,14-dione	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Quercus lusitanica has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHE583752.1 ↗373 bpPortugal

ACGT

CGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAAT …

Quercus lusitanica genomic DNA containing 5.8S rRNA gene, ITS2, isolate from Portugal

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Quercus lusitanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 248×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-fedorov +1

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — Recherches cytologiques sur quelques espces et hybrides du genre Quercus. Natividade, J.Bol. Soc. Brot. ser. 212: 21-85(1937).

CCDB · fl-europaea — Natividade, 1937

CCDB · book-fedorov — Natividade 1937

CCDB · book-atlas-flowering-plants — Natividade 1937

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 557 records

Wild obs. + sensor2 016

Museum / vouchered540

Cultivated / captive1

Origin

Native54

Range

Area of Occupancy AOO3 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 537≤1 km 84≤10 km 847>10 km 26

1 494 georeferenced · 522 without coordinates

Open the mapobservation + sensor2 016

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 11≤1 km 399≤10 km 14

424 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence540

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CICYTEXlocation not on record	370
ISAlocation not on record	58
Entomological Society of Latvialocation not on record	18
BClocation not on record	15
College of the Atlantic, Museumlocation not on record	6
Badajoz, ES	6
Wlocation not on record	5
Madrid, ES	4
Dresden, DE	4
Paris, FR	4
Madrid, ES	3
MAlocation not on record	3
University of Stellenboschlocation not on record	2
Salamanca, ES	2
Barcelona, ES	2
Granada, ES	2
Alicante, ES	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
València, ES	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Sevilla, ES	2
Phyletisches Museum Jenalocation not on record	1
Podgorica, ME	1
Rotorua, NZ	1
GJOlocation not on record	1
Kew, GB	1
Museo Achille Folettolocation not on record	1
Pamplona, ES	1
MeiseBGlocation not on record	1
Coimbra, PT	1
Helsinki, FI	1
LDlocation not on record	1
Córdoba, ES	1
St. Paul, US	1

34 institutions · 527 of 540 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Quercus lusitanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.4

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C 20.1–20.4

Min temp (night)9.00 °C 9.00–10.1

Precipitation33.4 mm/mo 33.4–63.0

Air humidity52.9 % 52.9–56.8

Moisture balance-61.7 mm/mo -61.7–-34.8

Vapour deficit953 Pa 834–953

Wind speed2.00 m/s 2.00–2.70

Cloud cover38.3 % 38.3–40.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Quercus lusitanica

At a glance

Sources12 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry4

Compound class profile5 classes

Documented compounds63 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 557 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions19 of 34 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 557 records