Quantula striata

(J.E.Gray, 1834) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Stylommatophora/Dyakiidae/Quantula

At a glance

Occurrence records813

Data sources7

Biological traits0

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Quantula striata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility813 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF813 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD5 specimens

01Narrative

Quantula striata, also known as Dyakia striata, is a species of medium-sized, air-breathing, tropical land snail. It is a terrestrial, pulmonate, gastropod mollusk in the family Dyakiidae. This species appears to be unique among terrestrial gastropods in that it is bioluminescent: Its eggs glow in the dark, and juveniles and most adults give off flashes of green light. It is the only species in the genus Quantula.Tumpeesuwan C., Naggs F. & Panha S. (31 August 2007) "A new genus and new species of dyakiid snail (Pulmonata: Dyakiidae) from the Phu Phan range, northeastern Thailand". Raffles Bulletin of Zoology 55(2) : 363-369. PDF

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Quantula striata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

13Avariable

96Cmostly conserved

157Gmostly conserved

535Amostly conserved

AACTTTATATATAATTTTTGGTGTGTGATGTGGTATGGTTGGTACTGGATTATCTTTGTTAATTCGTCTTGAATTGGGTACTGCCGGAGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes3

BIN1

Most divergent pair0.31%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phuphania crosseisame family12.2%Milax nigricanssame order12.9%Megaustenia praestanssame order13.0%Aegopinella purasame order13.0%Aegopinella minorsame order13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type813 records

Wild obs. + sensor780

Museum / vouchered33

Range

Area of Occupancy AOO984 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 236≤1 km 140≤10 km 59>10 km 83

518 georeferenced · 262 without coordinates

Open the mapobservation + sensor780

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	15
Chicago, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Denver, US	2
Kharazmi Universitylocation not on record	2
Ann Arbor, US	2
Cambridge, US	1
Paleontological Research Institutionlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Guermonprez Museumlocation not on record	1

10 institutions · 33 of 33 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Quantula striata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)