Pyxine petricola

Nyl. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Caliciales/Caliciaceae/Pyxine

At a glance

Occurrence records662

Data sources7

Biological traits1

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Pyxine petricola's data was compiled from.

GBIFGlobal Biodiversity Information Facility662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF662 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pyxine petricola has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAF540542.1 ↗445 bpVenezuela

ACGT

CCGAGAGACGGGGGTCTAACCGGCCCCAACTCTTCACCCGTGAGTGTTACAGCATTGTTGCTTTGGCGGATATTAATCCCGCCAGAGACC …

Pyxine petricola internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

08Occurrence & distribution

Record type662 records

Wild obs. + sensor228

Museum / vouchered434

Range

Area of Occupancy AOO1 152 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 59

59 georeferenced · 169 without coordinates

Open the mapobservation + sensor228

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 52≤1 km 33≤10 km 87>10 km 9

181 georeferenced · 253 without coordinates

Open the institutions mapphysical evidence434

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFMSlocation not on record	92
Brisbane, AU	61
ASUlocation not on record	43
Olocation not on record	38
Madison, US	32
Canberra, AU	29
LDlocation not on record	21
Uppsala, SE	19
Museo Entomologico de Leonlocation not on record	16
Berlin, DE	11
Chicago, US	9
Kensington, AU	9
St. Paul, US	8
DOI/NPS, Colonial National Historical Parklocation not on record	7
US	7
M-Lichenslocation not on record	6
Universidad Nacional de Colombia (UNAL)location not on record	4
Masindi, UG	3
IPA/SPlocation not on record	3
CEPLAClocation not on record	2
PHlocation not on record	2
Boise, US	1
Toronto, CA	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Bergen, NO	1
Antiguo Cuscatlán, SV	1
University of Stellenboschlocation not on record	1
Ann Arbor, US	1
Mexico City, MX	1
Durham, US	1
South Kensington, GB	1
UNESP-FCAlocation not on record	1

32 institutions · 433 of 434 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pyxine petricola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 25.8–25.8

Seasonal swing summer↔winter3.20 °C

Max temp (day)29.8 °C

Min temp (night)22.2 °C

Precipitation233 mm/mo

Air humidity65.4 %

Moisture balance79.7 mm/mo

Vapour deficit1,159 Pa

Wind speed2.50 m/s

Cloud cover28.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)