Python bivittatus

Kuhl, 1820 · species

image placeholder — illustration coming later

Animalia/Chordata/Squamata/Pythonidae/Python

At a glance

Occurrence records10 189

Data sources10

Biological traits10

DNA specimens43

eDNA detections46

Sources10 archives

Databases and archives Python bivittatus's data was compiled from.

WikipediaWikimedia Foundation18 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 189 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources10 traits

Occurrence & distributionGBIF10 189 records

Environmental DNA1 datasets · 2 countries46 detections

DNA & barcodingBOLD43 specimens

Genome at a glanceGoaT · NCBI≈1.4 Gbp

01Narrative

The dwarf Burmese python (Python bivittatus progschai) is an insular dwarf subspecies of the Burmese python. The dwarf Burmese python is native to the Indonesian islands of Java, Bali, Sumbawa, and Sulawesi. The dwarf subspecies seems to have a maximum length of 8.2 ft.de Lang R, Vogel G (2005). The Snakes of Sulawesi: A Field Guide to the Land Snakes of Sulawesi with Identification Keys. Frankfurt Contributions to Natural History Band 25, Edition Chimaira 2005. . pp. 23-27, 198-201. In 2009, the dwarf Burmese python was officially recognized as a subspecies of the Burmese python. They are often found in forests, and sometimes near bodies of fresh or brackish water. The subspecies seems to prefer hiding among old logs and tree stumps. However, like their larger mainland cousins, they also seem to enjoy the occasional dip in fresh or brackish water. They do seem to mostly nocturnal, with increased active between the hours of dusk to dawn.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAmnioteDB

Size & morphology1

Body mass17 100 g

Life cycle & reproduction9

Age at maturity (male)1 095 days

Age at sexual maturity1 095 days

Egg mass212 g

Gestation91.32 days

Incubation63.5 days

Litter size27.5

Litters per year1 /year

Max. longevity410 months

Neonate mass111 g

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Python bivittatus has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes1

eDNA detections46

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

10Tvariable

19Gmostly conserved

62Gmostly conserved

255Cmostly conserved

291Cmostly conserved

327Amostly conserved

471Gmostly conserved

627Gmostly conserved

TTATACCTATTATTTGGTGCATGATCCGGACTTGTAGGCGCCTGTTTAAGCGTATTAATACGAATAGAACTAACACAACCAGGCTCTTTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.43%

Haplotypes7

BIN1

Most divergent pair0.76%

OtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Python molurussame genus4.9%Python sebaesame genus13.6%Python regiussame genus14.1%Python natalensissame genus15.1%Liophidium torquatumsame order15.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_021479 ↗ · 13 protein · 22 tRNA · 2 rRNA

NADH dehydrogenase subunit 1NADH dehydrogenase subunit 2cytochrome c oxidase subunit Icytochrome c oxidase subunit IIATP synthase F0 subunit 8ATP synthase F0 subunit 6cytochrome c oxidase subunit IIINADH dehydrogenase subunit 3NADH dehydrogenase subunit 4LNADH dehydrogenase subunit 4NADH dehydrogenase subunit 5NADH dehydrogenase subunit 6cytochrome bs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Python bivittatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 435 034 535 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Python bivittatus1.44 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness89.2% BUSCO

07Deep time~7.18 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin7.18 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type10 189 records

Wild obs. + sensor1 734

Museum / vouchered309

Other8 146

Range

Area of Occupancy AOO7 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 837≤1 km 66≤10 km 26>10 km 744

1 673 georeferenced · 61 without coordinates

Open the mapobservation + sensor1 734

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 276≤1 km 8≤10 km 7>10 km 18

309 georeferenced

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	309

1 institutions · 309 of 309 vouchered records shown

09Environmental DNA46 detections

Where the DNA of Python bivittatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.8 °C 12.5–28.1

Seasonal swing summer↔winter8.40 °C

Max temp (day)29.6 °C 18.4–31.9

Min temp (night)22.2 °C 8.20–23.6

Precipitation135 mm/mo 79.6–137

Air humidity59.3 % 57.3–59.8

Moisture balance-38.4 mm/mo -42.5–-8.90

Vapour deficit1,349 Pa 733–1,523

Wind speed3.10 m/s 2.20–5.80

Cloud cover36.7 % 29.7–38.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Python bivittatus

At a glance

Sources10 archives

Size & morphology1

Life cycle & reproduction9

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type10 189 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 189 records