Pyrus communis
speciesAt a glance
Occurrence records67 994
Data sources17
Biological traits144
DNA specimens38
eDNA detections25
Sources17 archives
Databases and archives Pyrus communis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility67 993 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources144 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 855 compounds
Occurrence & distributionGBIF · PBDB67 994 records
Environmental DNA1 datasets · 5 countries25 detections
DNA & barcodingBOLD · NCBI38 specimens
Genome at a glanceCCDB · GoaT · NCBI597 Mbp
Deep timePBDB1 fossils
01Narrative
Le Poirier commun est une espèce de plantes à fleurs de la famille des Rosacées. C'est un arbre fruitier cultivé pour son fruit, la poire. Originaires des régions tempérées d'Europe et d'Asie de l'Ouest, les poiriers domestiques sont extrêmement variables puisque plusieurs milliers de cultivars distincts ont été recensés et sont cultivés dans près de 80 pays.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology25
Fruit length50 mm
Fruit length max50 mm
Fruit length min10 mm
Fruit width57.5 mm
⚠ sources differ — AusTraits: 57.5 mm · GIFT: 17.5 mm
Fruit width max20 mm
Fruit width min15 mm
Leaf length35 mm
Leaf length max98 mm
Leaf length min20 mm
Leaf width20 mm
⚠ sources differ — AusTraits: 20 mm · GIFT: 45 mm
Leaf width max45 mm
Leaf width min15 mm
Petiole length3.25 cm
Plant height17.3 m
⚠ sources differ — GIFT: 17.3 m · AusTraits: 10 m · LEDA: 20 m · USDA: 15.24 m · TRY: 18 m
Plant height generative6 m
Plant height max30 m
Plant height min3 m
Seed length6.75 mm
Seed length max6.5 mm
Seed length min3.5 mm
Seed mass30.06 mg
⚠ sources differ — TRY: 30.06 mg · LEDA: 25 mg · GIFT: 27.93 mg
Seed mass max37.04 mg
Seed mass min18.56 mg
Seed width max4.5 mm
Seed width min2 mm
Life cycle & reproduction36
Bloom periodEarly Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
Flower colourwhite
Flower conspicuousYes
Flower length max30 mm
Flower length min12 mm
Flower width max30 mm
Flowering endMay
Flowering startApr
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryShort
Lifespan years150 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityYes
Seed spread rateNone
Seedling vigorLow
Self fertilizationabsent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation min250 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colouryellow
Fruit typepome
Growth formtree
Growth form USDASingle Stem
Habitat GIFTÁrea Antrópica
Hedge toleranceLow
Known allelopathNo
Leaf compoundnesssimple
Leaf formorbicular
Leaf retentionNo
Leaf shapeelliptical orbicular ovate
Low growing grassNo
Mycorrhiza typeectomycorrhizal
Root depth min30 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry24
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementHigh
Fire resistantNo
Fire toleranceLow
Frost free days min175 days
Leaf c462 mg/g
Leaf n15.83 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min35 in
Protein potentialLow
Salinity toleranceLow
Shade toleranceHigh
Soil pH max6.7 pH
Soil pH min5.2 pH
Specific leaf area (SLA)11.24 mm²/mg
⚠ sources differ — TRY: 11.24 mm²/mg · LEDA: 7.41 mm²/mg · GIFT: 9.32 mm²/mg
Temperature min-18 °F
Wood density639 mg/cm³
Uses & economy16
Berry nut seed productYes
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalHigh
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound15 040 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typegerminule
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr12.19 m
Inflorescenceraceme
Planting density max1 200 per acre
Planting density min300 per acre
03Chemical composition5 855 compounds
Compounds documented for Pyrus communis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Aminoacids224
Cinnamic acids and derivatives140
Glycerophospholipids57
Pyridine alkaloids55
Flavan-3-ols50
Documented compounds5 855 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 62,200 mg/100g | FooDB | |
| Sucrose | 19,500 mg/100 g | FooDB |
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pyrus communis has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences8
eDNA detections25
Countries9
The DNA barcodea real sequence read deposited for this species
GTCCTCGGCGACGAACGCCACGATAATCGGTGGTTTCCCAACCTCGGTTGCATGTTGTGCGCTTTCGTCGCGCTCCGAGCGGCTCGCGAC …
Pyrus communis subsp. communis voucher VLB331 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL6★rbcLa★ITS2★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Pyrus communis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size596 580 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Pyrus communis0.60 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy2× diploid · measured
Chromosome records34–342n range34median34mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3425×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2730
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2731
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl — Gladkova, V. N. & L. I. Sveschnikova. 1990. On the cytosystematics of the genus Pyrus (Rosaceae). Bot. Žhurn. (Moscow & Leningrad) 75: 1261–1264.
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
CCDB · ipcn-api-dl — Pogan, E., H. Wcislow & A. Jankun. 1980. Further studies in chromosome numbers of Polish Angiosperms Part XlIl. Acta Biol. Cracov., Ser. Bot. 22: 37–69.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · book-ipcn67-71 — ZIELINSKI, Q. B., & M. M. THOMPSON. 1967. Speciation in Pyrus: chromosome number and meiotic behaviour. Bot. Gaz. 128: 109-112.
CCDB · book-indian_vol1 — Rybin, V.A. (Fedorov) ; Lawrence, W.J.C. 1930; Moffett, A.A. 193la, b; Adati, S. 1933; Tischler, G. 1934 ; Delay c. 1947
CCDB · eflora
CCDB · book-fedorov — Phl6HH 1926
CCDB · book-fedorov — Lawrence 1930
CCDB · book-fedorov — Moffett 1931a, b
CCDB · book-fedorov — Adati 1933
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Delay 1947
CCDB · book-atlas-flowering-plants — Marks 1953
CCDB · kew — Pustahija F, Brown SC, Bogunic F, Bašic N, Muratovic E, Ollier S, Hidalgo O, Bourge M, Stevanovic V, Sijak-Yakovev S. 2013. Small genomes dominate in plants growing on serpentine soils in West Balkans, an exhaustive study of 8 habitats covering 308 taxa.
CCDB · CromoCat 2015 — Chen, R.-y. (1993). Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas of Chinese Principal Economic Plants 1.
CCDB · CromoCat 2015 — Gladkova, V. N. & Sveschnikova, L. I. (1990). On the cytosystematics of the genus Pyrus (Rosaceae). Bot. Žurn. 75: 1261-1264.
CCDB · CromoCat 2015 — Pogan, E., H. Wisclo & A. Jankun. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov., Ser. Bot. 22: 37-69.
CCDB · CromoCat 2015 — Druskovic, B. & Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 15-19.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.1% BUSCO
07Deep time2.58–0.01 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range2.58–0.01 Ma Pleistocene
Dated fossil finds1
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Pyrus communis. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type67 994 records
Wild obs. + sensor55 875
Museum / vouchered8 255
Cultivated / captive2 376
Fossil1
Other1 487
Origin
Native90
Introduced2 966
Range
Area of Occupancy AOO150 616 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy59% within 1 km
≤100 m 18 242≤1 km 6 775≤10 km 17 008>10 km 358
42 383 georeferenced · 13 492 without coordinates
Open the mapobservation + sensor55 875
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 859≤1 km 1 456≤10 km 3 380>10 km 118
5 813 georeferenced · 2 442 without coordinates
Open the institutions mapphysical evidence8 255
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy75% within 1 km
≤100 m 72≤1 km 10≤10 km 12>10 km 16
110 georeferenced · 2 266 without coordinates
Open the mapnot free-living2 376
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions166 of 297 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 4 280 |
| BIO-UNIPIlocation not on record | 388 |
| ESP119location not on record | 229 |
| Moscow State Universitylocation not on record | 199 |
| ESP089location not on record | 170 |
| Uniwersytet Warszawskilocation not on record | 137 |
| AZE009location not on record | 131 |
| Görlitz, DE | 119 |
| LDlocation not on record | 111 |
| Karlsruhe, DE | 85 |
| SLU Artdatabankenlocation not on record | 74 |
| MeiseBGlocation not on record | 73 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 70 |
| Saint Louis, US | 70 |
| Adelaide, AU | 69 |
| DBF-NHMDlocation not on record | 58 |
| Oskarshamn, SE | 57 |
| Tartu, EE | 55 |
| Philadelphia, US | 55 |
| Beijing, CN | 46 |
| Olocation not on record | 36 |
| AUT023location not on record | 35 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 34 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 34 |
| Ann Arbor, US | 34 |
| Allentown, US | 33 |
| KMNlocation not on record | 33 |
| WTUlocation not on record | 31 |
| MAlocation not on record | 27 |
| BFLlocation not on record | 24 |
| Urumqi, CN | 23 |
| Voronezh State Universitylocation not on record | 22 |
| Durango, MX | 21 |
| Helsinki, FI | 20 |
| Williamsburg, US | 20 |
| Mexico City, MX | 18 |
| Bronx, US | 17 |
| Toronto, CA | 16 |
| Entomological Society of Latvialocation not on record | 16 |
| Moscow, US | 16 |
| Bangkok, TH | 15 |
| Chongqing Museumlocation not on record | 15 |
| University of Stellenboschlocation not on record | 14 |
| Mlocation not on record | 14 |
| Canberra, AU | 13 |
| New Haven, US | 12 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 12 |
| South Kensington, GB | 12 |
| Corvallis, US | 12 |
| BAYLUlocation not on record | 11 |
| Riverside, US | 11 |
| València, ES | 11 |
| Bern, CH | 11 |
| Wuzhou, CN | 11 |
| Salzburg, AT | 10 |
| Claremont, US | 10 |
| Jackson, US | 10 |
| Salamanca, ES | 10 |
| Burlington, US | 10 |
| Uppsala, SE | 9 |
| AUT006location not on record | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 9 |
| San Diego, US | 9 |
| Tlalnepantla, MX | 9 |
| Emporia, US | 9 |
| Tuscaloosa, US | 8 |
| BDBClocation not on record | 8 |
| Fort Worth, US | 8 |
| Chapel Hill, US | 7 |
| Auckland, NZ | 7 |
| Santa Barbara, US | 7 |
| Institute of Botany, Ilia State Universitylocation not on record | 7 |
| Puebla, MX | 7 |
| Mount Pleasant, US | 7 |
| Berlin, DE | 7 |
| University of New Hampshirelocation not on record | 7 |
| San Francisco, US | 7 |
| Denton, US | 7 |
| Baroda, IN | 7 |
| College Park, US | 6 |
| Madison, US | 6 |
| Yerevan, AM | 6 |
| Mount Annan, AU | 6 |
| BClocation not on record | 6 |
| Acadia Universitylocation not on record | 6 |
| Chengdu, CN | 6 |
| Christchurch, NZ | 6 |
| University of Southern Mississippilocation not on record | 6 |
| Wlocation not on record | 6 |
| Norfolk, US | 6 |
| Adam Mickiewicz University in Poznańlocation not on record | 6 |
| Museo Entomologico de Leonlocation not on record | 6 |
| Provincia di Livornolocation not on record | 6 |
| Millersville, US | 6 |
| Austin, US | 6 |
| Columbia, US | 5 |
| Durham, US | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Tallinn, EE | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Springfield, US | 5 |
| Staten Island, US | 5 |
| Flagstaff, US | 5 |
| Rotorua, NZ | 5 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| Barcelona, ES | 5 |
| Fredericksburg, US | 5 |
| Fayetteville, US | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Pullman, US | 5 |
| GJOlocation not on record | 4 |
| Pretoria, ZA | 4 |
| Chapingo, MX | 4 |
| Parkville, AU | 4 |
| Vitoria, ES | 4 |
| Davenport, US | 4 |
| CICYTEXlocation not on record | 4 |
| Alicante, ES | 4 |
| Jyväskylä, FI | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Kensington, AU | 4 |
| Porvoo, FI | 4 |
| Madrid, ES | 4 |
| ASUlocation not on record | 4 |
| Little Rock, US | 3 |
| Valdosta State Universitylocation not on record | 3 |
| Armidale, AU | 3 |
| Edmonton, CA | 3 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 3 |
| Bloomington, US | 3 |
| Salvador, BR | 3 |
| Tampa, US | 3 |
| McWane Science Centerlocation not on record | 3 |
| Nanjing, CN | 3 |
| Victoria, CA | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| BRNUlocation not on record | 3 |
| Frankfurt am Main | 3 |
| Vancouver, CA | 3 |
| Boise, US | 3 |
| Uniwersytet Jagiellońskilocation not on record | 3 |
| Nanjing, CN | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Philadelphia, US | 3 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Fairfax, US | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| Mississippi State, US | 3 |
| GB | 3 |
| Philadelphia, US | 3 |
| Phoenix, US | 2 |
| Johnson City, US | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| China Agricultural Universitylocation not on record | 2 |
| Pondicherry, IN | 2 |
| UFBAlocation not on record | 2 |
| Dover, US | 2 |
| EL PASO, US | 2 |
| Keene State Universitylocation not on record | 2 |
| Blumenau, BR | 2 |
| H-Diewaldlocation not on record | 2 |
| Knoxville, US | 2 |
| Logan, US | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Saint John, CA | 2 |
| Otaru, JP | 2 |
| Arcata, US | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Oulu, FI | 2 |
| Dekalb, US | 2 |
| Université Lavallocation not on record | 2 |
| Wellington, NZ | 2 |
| National Museum Waleslocation not on record | 2 |
| Angwin, US | 2 |
| Nijmegen, NL | 2 |
| Hudson, US | 2 |
| Miami, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Pittsburg, US | 2 |
| GAlocation not on record | 2 |
| Davis, US | 2 |
| Anhui Normal Universitylocation not on record | 2 |
| Québec, CA | 2 |
| US | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Clemson, US | 2 |
| GZUlocation not on record | 2 |
| Provo, US | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| FUNEDlocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Antiguo Cuscatlán, SV | 1 |
| PUC-RSlocation not on record | 1 |
| Tapachula, MX | 1 |
| San Jose, US | 1 |
| ISAlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| JBSlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Lanzhou, CN | 1 |
| Lincoln, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Morgantown, US | 1 |
| IAPlocation not on record | 1 |
| Porrentruy, CH | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| San Francisco, US | 1 |
| Lubbock, US | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Western Carolina Universitylocation not on record | 1 |
| MKD001location not on record | 1 |
| UTPLlocation not on record | 1 |
| Kuopio, FI | 1 |
| Chadron, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Jinghong, CN | 1 |
| UNESClocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Ojo, NG | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Banyoles, ES | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| Dresden, DE | 1 |
| Namur, BE | 1 |
| TROMlocation not on record | 1 |
| Denver, US | 1 |
| Russellville, US | 1 |
| Kingston, US | 1 |
| Montréal, CA | 1 |
| Durham, US | 1 |
| IANIGLAlocation not on record | 1 |
| Portland, US | 1 |
| Criciúma, BR | 1 |
| Mexico City, MX | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| AZE015location not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Sevilla, ES | 1 |
| AUAlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Cambridge, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Macomb, US | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Badajoz, ES | 1 |
| Juriquilla, MX | 1 |
| ARM059location not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Long Beach, US | 1 |
| AUT052location not on record | 1 |
| Kirksville, US | 1 |
| Kunming, CN | 1 |
| UFSMlocation not on record | 1 |
| Post Graduate College Bannulocation not on record | 1 |
| Trondheim, NO | 1 |
| San Luis Obispo, US | 1 |
| Batemans Bay, AU | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| UoB-IBlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Stephenville, US | 1 |
| Caldwell, US | 1 |
| San Sebastián, ES | 1 |
| Pamplona, ES | 1 |
| UDESC-CAVlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Albuquerque, US | 1 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 1 |
| Kew, GB | 1 |
| Tula State Universitylocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Chicago, US | 1 |
| Universidade da Região de Joinville - Univillelocation not on record | 1 |
| Stockholm, SE | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Dehra Dun, IN | 1 |
| UNIVILLElocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Turku, FI | 1 |
297 institutions · 7 874 of 8 255 vouchered records shown · 333 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Pyrus communis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map5 countries0
Mixed oak (coast live, Englemann, black) sav…roadside bordernext to path near old quarryAbandoned orchard.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.4 °C 10.0–20.9
Seasonal swing summer↔winter15.0 °C
Max temp (day)13.9 °C 13.3–28.1
Min temp (night)9.00 °C 6.60–16.3
Precipitation65.6 mm/mo 46.6–180
Air humidity63.8 % 58.8–64.6
Moisture balance-1.10 mm/mo
Vapour deficit487 Pa 451–1,132
Wind speed3.80 m/s
Cloud cover46.2 % 35.5–50.7
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.