Pyricularia oryzae

Cavara · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Magnaporthales/Pyriculariaceae/Pyricularia

At a glance

Occurrence records980

Data sources11

Biological traits0

DNA specimens2

eDNA detections52

Sources11 archives

Databases and archives Pyricularia oryzae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility980 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS62 compounds

Occurrence & distributionGBIF980 records

Environmental DNA5 datasets · 1 countries52 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈48 Mbp

01Narrative

Magnaporthe oryzae est une espèce de champignons ascomycètes haploïde, hétérothallique et filamenteuse, qui provoque la brunissure du riz ou pyriculariose et de plus de 50 autres espèces de Poaceae, émergeant même comme pathogène du blé dans le sud du Brésil.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition62 compounds

Compounds documented for Pyricularia oryzae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple aromatic polyketides8

Naphthalenones6

Miscellaneous polyketides5

Phenylethanoids4

Azaphilones4

Documented compounds62 total

Tissue Source Quantified only

Compound	Amount	Source
(11R,12S,13S)-Epoxy-hydroxyoctadeca-cis-9-cis-15-dien-1-oic acid	present	NPASS
(11S,12S,13S)-Epoxy-hydroxyoctadeca-cis-9-cis-15-dien-1-oic acid	present	NPASS
(1E,3S,4S,5E)-1-[3-hydroxy-2-(hydroxymethyl)phenyl]hepta-1,5-diene-3,4-diol	present	LOTUS
(2S)-4-acetyl-2-[(2R)-butan-2-yl]-3-hydroxy-1,2-dihydropyrrol-5-one	present	LOTUS
(3E,5R)-3-[(5S)-5-ethyloxolan-2-ylidene]-5-methyloxolane-2,4-dione	present	LOTUS
(3R,5S)-3-acetyl-5-propan-2-ylpyrrolidine-2,4-dione	present	LOTUS
(3S)-6,8-dihydroxy-3-methyl-3,4-dihydroisochromen-1-one	present	LOTUS
(3S,4R)-3-[(1E,3E)-penta-1,3-dienyl]-3,4-dihydro-1H-isochromene-4,8-diol	present	LOTUS
(3S,4S)-3,4,8-trihydroxytetralin-1-one	present	LOTUS
(4S)-4,6,8-trihydroxytetralin-1-one	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pyricularia oryzae has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences10

eDNA detections52

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPZ176611.1 ↗280 bpIndia · 2025

ACGT

ATAACCTCTGTCGTTGCTTCGGCGGGCACGCCCGCCGGAGGTTCAAAACTCTTATTTTTTTCAGTATCTCTGAGCCTAAAAGACAAATAA …

Pyricularia oryzae strain W1 BHU internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pyricularia oryzae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈47 777 704 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Pyricularia oryzae0.05 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness98.3% BUSCO

08Occurrence & distribution

Record type980 records

Wild obs. + sensor3

Museum / vouchered972

Cultivated / captive5

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤1 km 8≤10 km 7>10 km 3

18 georeferenced · 954 without coordinates

Open the institutions mapphysical evidence972

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	16
DPIlocation not on record	4
UFPElocation not on record	3
Catholic University of Pekinglocation not on record	3
Museo Entomologico de Leonlocation not on record	1
Auckland, NZ	1

6 institutions · 28 of 972 vouchered records shown · 944 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA52 detections

Where the DNA of Pyricularia oryzae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found52

Studies independent surveys5

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 52 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature12.2 °C 10.1–19.8

pH5.70 4.60–8.13

Conductivity227 µS/cm 15.0–53,000

Salinity30.7 PSU 18.9–35.0

Dissolved oxygen8.12 mg/L 5.76–9.40

Turbidity0.54 NTU 0.03–11.4

Organic carbon2.50 % 0.51–5.90

Water content22.3 % 3.04–45.0

Nitrate-N10.5 mg/kg 2.00–59.0

Phosphorus12.0 mg/kg 3.00–26.0

Clay24.1 % 3.97–46.9

Sand43.7 % 17.8–83.8

Depth0.2 m 0–24.0

Coastal waterSoilSodosolDermosolVertosol

38 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 7.20–22.2

Seasonal swing summer↔winter8.50 °C

Max temp (day)14.5 °C 10.2–27.2

Min temp (night)8.50 °C 3.90–17.8

Precipitation57.1 mm/mo 49.7–135

Air humidity58.9 % 57.3–61.6

Moisture balance-5.50 mm/mo -77.7–10.8

Vapour deficit555 Pa 393–1,103

Wind speed3.70 m/s 1.70–5.50

Cloud cover40.2 % 26.0–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)