Pyrenula ochraceoflava

(Nyl.) R.C.Harris · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Pyrenulales/Pyrenulaceae/Pyrenula

At a glance

Occurrence records2 201

Data sources6

Biological traits1

DNA specimens3

eDNA detections3

Sources6 archives

Databases and archives Pyrenula ochraceoflava's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 201 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 201 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pyrenula ochraceoflava has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences8

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKC592275.1 ↗589 bpUSA

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACGAAGTATGGTCAGGCCTCCGGGCCGGACTTTCAACCCCTTGTT …

Pyrenula ochraceoflava strain CBS 132741 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8★ITS1

fungal barcode

08Occurrence & distribution

Record type2 201 records

Wild obs. + sensor1 763

Museum / vouchered437

Cultivated / captive1

Origin

Native1

Range

Area of Occupancy AOO1 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 2≤1 km 4≤10 km 1>10 km 3

10 georeferenced · 1 753 without coordinates

Open the mapobservation + sensor1 763

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 126≤1 km 31≤10 km 29>10 km 5

191 georeferenced · 246 without coordinates

Open the institutions mapphysical evidence437

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	190
Masindi, UG	49
Berlin, DE	32
MeiseBGlocation not on record	20
Chicago, US	20
US	16
Canberra, AU	15
ILLSlocation not on record	15
Madison, US	9
Bronx, US	8
DOI/NPS, Colonial National Historical Parklocation not on record	7
Brisbane, AU	7
FLASlocation not on record	6
Durham, US	3
LDlocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Chapel Hill, US	3
University of Stellenboschlocation not on record	2
PHlocation not on record	2
Auckland, NZ	2
National Biodiversity Institute, Costa Ricalocation not on record	2
ASUlocation not on record	2
EL PASO, US	2
Helsinki, FI	2
South Kensington, GB	2
AUAlocation not on record	2
Hobart, AU	1
Chicago, US	1
Museo Entomologico de Leonlocation not on record	1
Mount Annan, AU	1
Philadelphia, US	1
Adelaide, AU	1
St. Paul, US	1
Santa Barbara, US	1
Boise, US	1
UFPElocation not on record	1
Göteborg, SE	1
Fort Worth, US	1

38 institutions · 436 of 437 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Pyrenula ochraceoflava was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pyrenula ochraceoflava

At a glance

Sources6 archives

Habitat & environment1

At a glance

Record type2 201 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions25 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 201 records