Pyrenula macrospora

(Degel.) Coppins & P.James · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Pyrenulales/Pyrenulaceae/Pyrenula

At a glance

Occurrence records3 360

Data sources6

Biological traits0

DNA specimens2

eDNA detections1

Sources6 archives

Databases and archives Pyrenula macrospora's data was compiled from.

GBIFGlobal Biodiversity Information Facility3 360 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF3 360 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pyrenula macrospora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ927455.1 ↗587 bp

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAGTTAGGGTCCTCTGGGCCCGATCTCCAACCCTGTGTTTAA …

Pyrenula macrospora voucher CG1520a small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type3 360 records

Wild obs. + sensor3 263

Museum / vouchered97

Range

Area of Occupancy AOO8 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 1 050≤1 km 983≤10 km 1 217>10 km 3

3 253 georeferenced · 10 without coordinates

Open the mapobservation + sensor3 263

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 31≤1 km 11≤10 km 9

51 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	17
Bergen, NO	16
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	12
Kew, GB	6
MeiseBGlocation not on record	6
nbflocation not on record	5
Berlin, DE	5
San Sebastián, ES	3
CLUlocation not on record	3
Trondheim, NO	3
TSBlocation not on record	3
Chicago, US	2
South Kensington, GB	2
LDlocation not on record	2
Madrid, ES	1
Durham, US	1
BioFokuslocation not on record	1
Weber State Universitylocation not on record	1
Uppsala, SE	1
Royal Botanic Garden Edinburghlocation not on record	1
US	1
St. Paul, US	1

22 institutions · 93 of 97 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Pyrenula macrospora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pyrenula macrospora

At a glance

Sources6 archives

At a glance

Record type3 360 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type3 360 records