Pycnanthemum floridanum

E.Grant & Epling · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Lamiaceae/Pycnanthemum

At a glance

Occurrence records91

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Pycnanthemum floridanum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility91 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS37 compounds

Occurrence & distributionGBIF91 records

DNA & barcodingNCBIsequences

01Narrative

Pycnanthemum floridanum là một loài thực vật có hoa trong họ Hoa môi. Loài này được E.Grant & Epling miêu tả khoa học đầu tiên năm 1943.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition37 compounds

Compounds documented for Pycnanthemum floridanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Menthane monoterpenoids $ Monocyclic monoterpenoids9

Fatty alcohols2

Aromadendrane sesquiterpenoids2

Cadinane sesquiterpenoids2

Thujane monoterpenoids2

Documented compounds37 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Menthofuran	present	LOTUS
(+)-Menthone	present	LOTUS
(+)-Neomenthol	present	LOTUS
(+)-pulegone	present	LOTUS
(-)-gamma-Cadinene	present	LOTUS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene	present	LOTUS
(2S,4R)-1,7,7-trimethylbicyclo(2.2.1)heptan-2-ol	present	LOTUS
(5S)-4-methylidene-1-propan-2-ylbicyclo[3.1.0]hexane	present	LOTUS
(R)-1-Octen-3-ol	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pycnanthemum floridanum has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

rbcLKJ773798.1 ↗1 242 bp

ACGT

TGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAG …

Pycnanthemum floridanum ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type91 records

Wild obs. + sensor49

Museum / vouchered41

Other1

Range

Area of Occupancy AOO228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 27≤1 km 5>10 km 8

40 georeferenced · 9 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 4≤1 km 1≤10 km 1>10 km 8

14 georeferenced · 27 without coordinates

Open the institutions mapphysical evidence41

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	11
Miami, US	7
Chapel Hill, US	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Saint Louis, US	3
Valdosta State Universitylocation not on record	3
Bronx, US	2
GAlocation not on record	1
Tall Timbers Research Stationlocation not on record	1
Tampa, US	1
Chongqing Museumlocation not on record	1
Jackson, US	1
McWane Science Centerlocation not on record	1

13 institutions · 41 of 41 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)