Puya spathacea

(Griseb.) Mez · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Puya

At a glance

Occurrence records251

Data sources12

Biological traits13

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Puya spathacea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF251 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 50

01Narrative

Puya spathacea is a species in the genus Puya. This species is native to Bolivia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 800 m

Elevation min1 400 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Puya spathacea across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthocyanidins7

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
Cyanidin 3-glucoside	present	LOTUS
cyanidin-3,5-diglucoside	present	LOTUS
Delphinidin 3,5-diglucoside	present	LOTUS
Delphinidin 3-glucoside	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puya spathacea has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

matKEU681902.1 ↗1 746 bp

ACGT

ACCTCCTGCCTCTGGCTCAAGTAGAAATGTAAATGGAAGAATTACAAGGATATTTAGAAAAAGATAGATCTCGGCAACAACACTTCCTAT …

Puya spathacea isolate F52a tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, complete cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Puya spathacea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 501×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Lindschau 1933

n 252×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Brown, G. K. & A. J. Gilmartin. 1989. Chromosome numbers in Bromeliaceae. Amer. J. Bot. 76(5): 657–665.

CCDB · book-ipcn67-71 — MARCHANT, C. J. 1967. Chromosome evolution in the Bromeliaceae. Kew Bull. 21: 161-168.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type251 records

Wild obs. + sensor149

Museum / vouchered102

Origin

Native32

Range

Area of Occupancy AOO600 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 41≤1 km 37≤10 km 14

92 georeferenced · 57 without coordinates

Open the mapobservation + sensor149

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤1 km 5≤10 km 2

7 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence102

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	56
University of Stellenboschlocation not on record	9
Wlocation not on record	6
Fundación Miguel Lillolocation not on record	6
Madison, US	4
BAlocation not on record	3
Chicago, US	3
Buenos Aires, AR	2
San Isidro, AR	2
Cambridge, US	2
Bronx, US	1
BMlocation not on record	1
Zlocation not on record	1
Berlin, DE	1
Pullman, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Glocation not on record	1
Universität Göttingenlocation not on record	1
Corrientes, AR	1

19 institutions · 102 of 102 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Puya spathacea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)