Punctularia strigosozonata

(Schwein.) P.H.B.Talbot · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Corticiales/Punctulariaceae/Punctularia

At a glance

Occurrence records1 059

Data sources10

Biological traits0

DNA specimens3

eDNA detections11

Sources10 archives

Databases and archives Punctularia strigosozonata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 059 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS46 compounds

Occurrence & distributionGBIF1 059 records

Environmental DNA3 datasets · 3 countries11 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceNCBI34 Mbp

01Narrative

Punctularia strigosozonata is a fungus species of the genus Punctularia. It was originally described in 1832 by Lewis David de Schweinitz as a member of genus Merulius. Patrick Talbot transferred it to genus Punctularia in 1958. Punctularia strigosozonata produces the antibiotic phlebiarubrone.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition46 compounds

Compounds documented for Punctularia strigosozonata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple indole alkaloids10

Aporphine alkaloids $ Isoquinoline alkaloids9

Kaurane and Phyllocladane diterpenoids1

Pyrrolidine alkaloids1

Aporphine alkaloids1

Documented compounds46 total

Tissue Source Quantified only

Compound	Amount	Source
(12R)-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaene-11-carboxamide	present	NPASS
(2R)-1-[5-[[(2S)-3,3-dimethyloxiran-2-yl]methyl]-1H-indol-3-yl]-3-methylbutane-2,3-diol	present	NPASS
(2R)-3-methyl-2-[6-(3-methylbut-2-enyl)-1H-indol-3-yl]butane-1,3-diol	present	NPASS
(2S)-2-[[(2Z,4E)-hexa-2,4-dienoyl]amino]-4-[(2Z,4E)-hexa-2,4-dienoyl]sulfanylbutanoic acid	present	LOTUS
(2S)-2-[[(E)-2,3-dihydroxyhex-4-enoyl]amino]-4-[(2E,4E)-hexa-2,4-dienoyl]sulanylbutanoic acid	present	LOTUS
(2S)-2-[[(E)-2,5-dihydroxyhex-3-enoyl]amino]-4-[(2E,4E)-hexa-2,4-dienoyl]sulanylbutanoic acid	present	LOTUS
(2S)-2-methoxypyrrolidine-1-carboxamide	present	NPASS
(2S)-3-methyl-1-[6-(3-methylbut-2-enyl)-1H-indol-3-yl]butane-2,3-diol	present	NPASS
(6aR)-2-hydroxy-1-methoxy-5,6,6a,7-tetrahydro-4H-dibenzo[de,g]quinoline-6-carboxamide	present	NPASS
(E)-4-[3-[[(2R)-3,3-dimethyloxiran-2-yl]methyl]-1H-indol-2-yl]-2-methylbut-3-en-2-ol	present	NPASS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Punctularia strigosozonata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences9

eDNA detections11

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMN430943.1 ↗408 bpUSA

ACGT

TTATCGAGTTCTGAAAGGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACACTCTCTCTCTCTACACCTGTGCACC …

Punctularia strigosozonata strain KRT_Iso_25 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceNCBI

The complete instruction manual Punctularia strigosozonata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size34 170 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Punctularia strigosozonata0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 059 records

Wild obs. + sensor684

Museum / vouchered375

Origin

Native4

Range

Area of Occupancy AOO3 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 279≤1 km 143≤10 km 47>10 km 50

519 georeferenced · 165 without coordinates

Open the mapobservation + sensor684

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 33≤1 km 25≤10 km 130>10 km 22

210 georeferenced · 165 without coordinates

Open the institutions mapphysical evidence375

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	95
Chicago, US	42
Helsinki, FI	36
DPIlocation not on record	19
Kensington, AU	19
Tartu, EE	16
Philadelphia, US	16
Olocation not on record	12
Toronto, CA	11
Canberra, AU	11
Université de Montréal Biodiversity Centrelocation not on record	10
Bronx, US	7
Brisbane, AU	6
Catholic University of Pekinglocation not on record	4
Metsähallituslocation not on record	4
Joensuu, FI	3
CA	3
Baton Rouge, US	3
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Ann Arbor, US	2
Hobart, AU	2
St. Paul, US	2
Colorado State Universitylocation not on record	2
Palmerston, AU	2
Copenhagen, DK	2
Tomioka, JP	2
Odawara, JP	1
Université Lavallocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1
TENN-Flocation not on record	1
Chiba, JP	1
Auckland, NZ	1
Harvard University, The Gray Herbariumlocation not on record	1
MAlocation not on record	1
National Institute of Biological Resourceslocation not on record	1
WTUlocation not on record	1
Cincinnati, US	1
Parkville, AU	1
Oulu, FI	1
Smithfield, AU	1
Royal Ontario Museum, TRTC Fungariumlocation not on record	1
Davis and Elkins Collegelocation not on record	1
Adelaide, AU	1
Uppsala, SE	1

44 institutions · 352 of 375 vouchered records shown · 23 without an institution code

09Environmental DNA11 detections

Where the DNA of Punctularia strigosozonata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys3

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.5 °C 21.5–22.8

pH7.08 6.79–7.14

Salinity29.7 PSU 29.0–30.3

Turbidity1.90 NTU 0.6–3.00

Depth0 m

Coastal water

5 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 10.5–22.0

Seasonal swing summer↔winter10.2 °C

Max temp (day)22.7 °C 16.2–23.9

Min temp (night)14.6 °C 5.00–20.2

Precipitation88.2 mm/mo 46.9–106

Air humidity60.6 % 54.7–62.1

Moisture balance-71.0 mm/mo -81.7–-48.6

Vapour deficit869 Pa 610–997

Wind speed4.10 m/s 2.50–4.70

Cloud cover30.1 % 20.1–40.5

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Punctularia strigosozonata

At a glance

Sources10 archives

Compound class profile5 classes

Documented compounds46 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 059 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions27 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 059 records