Punctularia atropurpurascens

(Berk. & Broome) Petch · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Corticiales/Punctulariaceae/Punctularia

At a glance

Occurrence records1 418

Data sources9

Biological traits0

DNA specimens2

eDNA detections12

Sources9 archives

Databases and archives Punctularia atropurpurascens's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 418 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Chemical compositionLOTUS · NPASS26 compounds

Occurrence & distributionGBIF1 418 records

Environmental DNA4 datasets · 7 countries12 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition26 compounds

Compounds documented for Punctularia atropurpurascens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Quassinoids16

Kaurane and Phyllocladane diterpenoids3

Drimane sesquiterpenoids1

Norkaurane diterpenoids1

Documented compounds26 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,3R,6S,7R,8S,12S,13S,14R,15R,16S,17R)-2,3,7,12,15,16-hexahydroxy-9,13,17-trimethyl-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-ene-4,11-dione	present	NPASS
(1R,2S,3R,7S,9R,14R,16R,17R)-3,16-dihydroxy-14-[(2S,3R)-3-(hydroxymethyl)-5-oxooxolan-2-yl]-2,6,14,17-tetramethyl-10-oxatetracyclo[7.7.1.02,7.013,17]heptadeca-5,12-diene-4,11-dione	present	NPASS
(1R,2S,3S,7S,9R,14R,16R,17R)-3,16-dihydroxy-14-[(2S,3R)-3-(hydroxymethyl)-5-oxooxolan-2-yl]-2,6,14,17-tetramethyl-10-oxatetracyclo[7.7.1.02,7.013,17]heptadeca-5,12-diene-4,11-dione	present	NPASS
(1R,2S,6S,7R,8S,12S,13S,14R,15R,16S,17R)-2,7,12,15,16-pentahydroxy-9,13,17-trimethyl-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-ene-4,11-dione	present	NPASS
(1R,4R,5S,9S,10R,11R,12R,13S,14S,15S)-5,10,13,14,15-pentahydroxy-4,12,16-trimethyl-3,8-dioxapentacyclo[9.8.0.01,5.04,9.012,17]nonadeca-16,18-dien-7-one	present	NPASS
(1R,4S,5R,8S,9R,10R,11R,12S,13S,15S)-9,12,13,15-tetrahydroxy-4,11,15-trimethyl-3,7-dioxapentacyclo[8.8.0.01,5.04,8.011,16]octadec-16-ene-6,18-dione	present	NPASS
(1R,4S,5R,8S,9R,10R,11S,12S,13S,16S)-9,12-dihydroxy-4,11,15-trimethyl-13-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,7-dioxapentacyclo[8.8.0.01,5.04,8.011,16]octadec-14-ene-6,18-dione	present	NPASS
(1R,4S,5R,8S,9R,10R,11S,12S,15R,16S)-9,12-dihydroxy-4,11,15-trimethyl-3,7-dioxapentacyclo[8.8.0.01,5.04,8.011,16]octadecane-6,13,18-trione	present	NPASS
(1R,4S,5R,8S,9R,10R,11S,12S,16S,18R)-9,12,18-trihydroxy-4,11,15-trimethyl-3,7-dioxapentacyclo[8.8.0.01,5.04,8.011,16]octadec-14-ene-6,13-dione	present	NPASS
1-alpha-Hydroxy-isodrimenine	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Punctularia atropurpurascens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections12

Countries7

The DNA barcodea real sequence read deposited for this species

ITSON897942.1 ↗556 bpChina

ACGT

TCGAGTTCTGAAAGGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTCTCTACACCTGTGCACCTTTTGTGGG …

Punctularia atropurpurascens voucher LWZ 20210922-4a internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type1 418 records

Wild obs. + sensor1 381

Museum / vouchered37

Range

Area of Occupancy AOO2 676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 756≤1 km 225≤10 km 82>10 km 54

1 117 georeferenced · 264 without coordinates

Open the mapobservation + sensor1 381

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 36 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	12
Olocation not on record	3
California State University, East Baylocation not on record	2
Helsinki, FI	2
Kew, GB	1
Chicago, US	1
MAlocation not on record	1
UFPElocation not on record	1

8 institutions · 23 of 37 vouchered records shown · 14 without an institution code

09Environmental DNA12 detections

Where the DNA of Punctularia atropurpurascens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys4

Countries7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map7 countries0

ForestNeotropic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 8.50–22.6

Seasonal swing summer↔winter13.1 °C

Max temp (day)19.2 °C 14.3–26.5

Min temp (night)9.10 °C 4.50–16.1

Precipitation92.4 mm/mo 13.4–126

Air humidity57.8 % 55.0–61.7

Moisture balance-16.3 mm/mo -90.9–38.3

Vapour deficit709 Pa 466–1,252

Wind speed2.60 m/s 1.80–3.80

Cloud cover35.4 % 26.2–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Punctularia atropurpurascens

At a glance

Sources9 archives

Compound class profile4 classes

Documented compounds26 total

At a glance

Record type1 418 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 418 records