Punctelia perreticulata

(Räsänen) G.Wilh. & Ladd · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Punctelia

At a glance

Occurrence records1 031

Data sources7

Biological traits1

DNA specimens5

eDNA detections5

Sources7 archives

Databases and archives Punctelia perreticulata's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 031 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF1 031 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Punctelia perreticulata is a widely distributed species of foliose lichen in the family Parmeliaceae. It occurs in Mediterranean Europe and Russia, North America, South America, Australia, and New Zealand, where it grows on rocks, bark, or wood. Its main distinguishing features are its thallus surface, marked with many shallow depressions, grooves, or pits, and sorediate pseudocyphellae. The lower side of the thallus is ivory to tan towards the centre and the major secondary metabolite in the medulla is lecanoric acid. A lookalike species with which it has been historically confused is Punctelia subrudecta; this lichen can be distinguished from Punctelia perreticulata by the texture of the thallus surface, or, more reliably, by the length of its conidia (asexual spores).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Punctelia perreticulata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes1

GenBank sequences6

eDNA detections5

Countries4

The DNA barcodea real sequence read deposited for this species

ITSHM016967.1 ↗456 bpMorocco

ACGT

GAGAGAGGGGCCTCGCGCTCCGGGGGTTCACCCTCAACTCTTCACCCATTGTCTACATACCTTTGTTGCTTTGGCGGACCTCGGGTTCCT …

Punctelia perreticulata voucher MAF-Lich 16140 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS6

fungal barcode

08Occurrence & distribution

Record type1 031 records

Wild obs. + sensor343

Museum / vouchered688

Origin

Native1

Range

Area of Occupancy AOO2 336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 302≤1 km 5≤10 km 2>10 km 30

339 georeferenced · 4 without coordinates

Open the mapobservation + sensor343

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 21≤1 km 15≤10 km 44

80 georeferenced · 608 without coordinates

Open the institutions mapphysical evidence688

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
St. Paul, US	354
ASUlocation not on record	130
Museum of the Rockieslocation not on record	31
Bronx, US	26
Mexico City, MX	19
Wuzhou, CN	14
Boise, US	10
Madison, US	9
Durham, US	9
BDBClocation not on record	8
Vancouver, CA	6
Chicago, US	6
DOI/NPS, Colonial National Historical Parklocation not on record	6
LDlocation not on record	6
PHlocation not on record	5
University of Stellenboschlocation not on record	4
MeiseBGlocation not on record	4
Oregon State Universitylocation not on record	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Fort Hayslocation not on record	3
Olocation not on record	3
EL PASO, US	3
Bozeman, US	3
Catholic University of Pekinglocation not on record	3
Helsinki, FI	2
Uppsala, SE	2
US	2
Anchorage, US	1
Museo Achille Folettolocation not on record	1
Philadelphia, US	1
TSBlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
University of Gdansklocation not on record	1
Albuquerque, US	1
Cambridge, US	1
WTUlocation not on record	1
Santa Barbara, US	1
College Park, US	1
Davis, US	1
San Diego, US	1

40 institutions · 687 of 688 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Punctelia perreticulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–15.2

Seasonal swing summer↔winter21.1 °C

Max temp (day)20.1 °C

Min temp (night)9.00 °C

Precipitation33.4 mm/mo

Air humidity52.9 %

Moisture balance-61.7 mm/mo

Vapour deficit953 Pa

Wind speed2.00 m/s

Cloud cover38.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Punctelia perreticulata

At a glance

Sources7 archives

Habitat & environment1

At a glance

Record type1 031 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 031 records