Punctelia missouriensis

Wilhelm & Ladd · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Punctelia

At a glance

Occurrence records1 015

Data sources8

Biological traits0

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Punctelia missouriensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 015 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 015 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Punctelia missouriensis, commonly known as the mealy speckled shield lichen, is a species of foliose lichen in the family Parmeliaceae. It is found in the southeastern United States, where it grows on tree bark and on rocks.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Punctelia missouriensis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU384892.1 ↗540 bpUSA

ACGT

TAAAACTAACAAGGTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAGAGAGGGGCTTCGCGCTCCCGGGGGCTTCGGCCCCCAACTC …

Punctelia missouriensis isolate NY164 18S ribosomal RNA gene, partial sequence; and internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type1 015 records

Wild obs. + sensor314

Museum / vouchered701

Range

Area of Occupancy AOO3 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 103≤1 km 20≤10 km 9>10 km 78

210 georeferenced · 104 without coordinates

Open the mapobservation + sensor314

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 2≤1 km 49≤10 km 117>10 km 2

170 georeferenced · 531 without coordinates

Open the institutions mapphysical evidence701

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	304
Museum of the Rockieslocation not on record	147
Wuzhou, CN	86
PHlocation not on record	23
ASUlocation not on record	20
St. Paul, US	18
DOI/NPS, Colonial National Historical Parklocation not on record	12
Chapel Hill, US	11
Durham, US	10
UFMSlocation not on record	9
ILLSlocation not on record	7
Chicago, US	6
Madison, US	6
Oregon State Universitylocation not on record	4
AUAlocation not on record	4
Stockholm, SE	3
Bergen, NO	3
Philadelphia, US	3
MeiseBGlocation not on record	3
McWane Science Centerlocation not on record	3
University of Stellenboschlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
LDlocation not on record	2
Champaign, US	2
Minia, EG	2
Laboratorio de Ictiologialocation not on record	2
Baton Rouge, US	1
US	1
Durham, US	1
Uppsala, SE	1
Western Carolina Universitylocation not on record	1
Santa Barbara, US	1
EL PASO, US	1

33 institutions · 701 of 701 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Punctelia missouriensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Punctelia missouriensis

At a glance

Sources8 archives

At a glance

Record type1 015 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions18 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 015 records