Punctelia caseana

Lendemer & B.P.Hodk. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Lecanorales/Parmeliaceae/Punctelia

At a glance

Occurrence records1 730

Data sources9

Biological traits0

DNA specimens9

eDNA detections9

Sources9 archives

Databases and archives Punctelia caseana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 730 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 730 records

Environmental DNA1 datasets · 0 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaT · NCBI≈35 Mbp

01Narrative

Punctelia caseana is a species of foliose lichen in the family Parmeliaceae. Its range covers eastern North America, extending south to central and northern Mexico, where it grows on the bark of many species of hardwood and conifer trees.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Punctelia caseana has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes1

GenBank sequences10

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON116056.1 ↗522 bpCanada

ACGT

CCTGCGGAAGGATCATTACCGAGAGAGGGGCTTTTCGTCCCCGGGGGCTTCGGCCCCCAACTCTTCACCCATTGTGTACCTACCTTTGTT …

Punctelia caseana isolate SG253 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Punctelia caseana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈35 374 370 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Punctelia caseana0.04 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type1 730 records

Wild obs. + sensor468

Museum / vouchered1 261

Other1

Origin

Native1

Range

Area of Occupancy AOO4 892 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy69% within 1 km

≤100 m 220≤1 km 51≤10 km 17>10 km 106

394 georeferenced · 74 without coordinates

Open the mapobservation + sensor468

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤1 km 2≤10 km 15

18 georeferenced · 1 243 without coordinates

Open the institutions mapphysical evidence1 261

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	980
Durham, US	95
DOI/NPS, Colonial National Historical Parklocation not on record	27
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	23
Madison, US	21
Oregon State Universitylocation not on record	17
Wuzhou, CN	15
Chapel Hill, US	11
New Brunswick, US	10
ASUlocation not on record	8
US	8
Fort Hayslocation not on record	7
St. Paul, US	6
Museo Achille Folettolocation not on record	4
Chicago, US	3
Santa Barbara, US	3
Philadelphia, US	3
Stockholm, SE	2
Uppsala, SE	2
Durham, US	2
Christchurch, NZ	2
AUAlocation not on record	2
Cambridge, US	2
LDlocation not on record	2
Bergen, NO	1
McWane Science Centerlocation not on record	1
Université Lavallocation not on record	1
Hobart, AU	1
University of Gdansklocation not on record	1
Fort Worth, US	1

30 institutions · 1 261 of 1 261 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Punctelia caseana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Punctelia caseana

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 730 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 730 records