Pulicaria stephanocarpa — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pulicaria

At a glance

Occurrence records43

Data sources9

Biological traits1

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Pulicaria stephanocarpa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Chemical compositionNPASS1 compounds

Occurrence & distributionGBIF43 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Pulicaria stephanocarpa is a species of flowering plant in the family Asteraceae. It is found only in Yemen. Its natural habitats are subtropical or tropical dry shrubland and rocky areas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Pulicaria stephanocarpa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cadinane sesquiterpenoids1

Documented compounds1 total

Compound	Class	Amount	Source
Alpha-Cadinol		present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pulicaria stephanocarpa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSFM995405.1 ↗798 bp

ACGT

AGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCTATAAAGCAGAAAGACCCGTGAACGTGTAACAAC …

Pulicaria stephanocarpa 18S rRNA gene (partial), ITS1, 5.8S rRNA gene and ITS2, specimen voucher S:Kilian et al. YP2338

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type43 records

Wild obs. + sensor26

Museum / vouchered17

Range

Area of Occupancy AOO100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 18≤1 km 2≤10 km 2

22 georeferenced · 4 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	7
Kew, GB	2
Stockholm, SE	1
CASlocation not on record	1
MAlocation not on record	1
University of Stellenboschlocation not on record	1
Wlocation not on record	1
Uppsala, SE	1
Edinburgh, GB	1

9 institutions · 16 of 17 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Pulicaria stephanocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.