Pulicaria dysenterica
(L.) Bernh. · speciesAt a glance
Occurrence records234 970
Data sources14
Biological traits46
DNA specimens20
eDNA detections11
Sources14 archives
Databases and archives Pulicaria dysenterica's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility234 970 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics20 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources46 traits
Chemical compositionLOTUS · NPASS96 compounds
Occurrence & distributionGBIF234 970 records
Environmental DNA1 datasets · 3 countries11 detections
DNA & barcodingBOLD · NCBI20 specimens
Genome at a glanceCCDB · GoaT · NCBI1.1 Gbp
01Narrative
Pulicaria dysenterica, the common fleabane, or, in North America, meadow false fleabane, is a species of fleabane in the family Asteraceae. It is native to Europe and western Asia where it grows in a variety of habitats ranging from semi-arid Mediterranean woodlands to wetter situations. Pulicaria dysenterica is perennial and can form dense clusters of plants, spreading by its roots. It flowers at its maximum height of about 60 cm. Leaves are alternately arranged and clasp the stem, which itself contains a salty-astringent liquid. The yellow inflorescences are typically composed of a prominent centre of 40–100 disc florets surrounded by 20–30 narrow, pistillate ray florets. When setting seed the flower heads reflex. Common fleabane is the main food plant for the Fleabane Tortoise Beetle (Cassida murraea), and for four micromoths, Apodia bifractella, Ptocheuusa paupella, Dusky Plume (Oidaematophorus lithodactyla) and Digitivalva pulicariae. Fleabane's common name comes from its former use as an incense to drive away insects. Other past uses include treatments for dysentery and unspecified ocular maladies.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology14
Leaf length max40 mm
Leaf mass39.33 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 200 mm² · GIFT: 1 200 mm²
Leaf width15 mm
Leaf width max15 mm
Leaf width min15 mm
Plant height0.475 m
⚠ sources differ — GIFT: 0.475 m · LEDA: 0.45 m · TRY: 0.403 m
Plant height generative0.412 m
Plant height max0.9 m
Plant height min0.2 m
Seed length1.5 mm
Seed mass0.068 mg
⚠ sources differ — TRY: 0.068 mg · LEDA: 0.1 mg · GIFT: 0.074 mg
Seed mass max0.08 mg
Seed mass min0.06 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: dysochor · GIFT: anemochorous
Flowering endSep
Flowering startJul
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number1 895
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation min300 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Mycorrhiza type0.0000000793
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)163 mg/g
⚠ sources differ — TRY: 163 mg/g · LEDA: 142 mg/g
Photosynthetic pathwayC3
Seed longevity index0.25
Specific leaf area (SLA)30.54 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition96 compounds
Compounds documented for Pulicaria dysenterica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Caryophyllane sesquiterpenoids30
Halogenated hydrocarbons19
Flavonols4
Menthane monoterpenoids2
Acyclic monoterpenoids $ Wax monoesters1
Documented compounds96 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | LOTUS | |
| (1R,4R,9R)-4-(hydroxymethyl)-11,11-dimethyl-8-methylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS | |
| (1R,4R,9R,11R)-4,11-bis(hydroxymethyl)-11-methyl-8-methylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS | |
| (1R,4S,5S,9R,11S)-11-(hydroxymethyl)-5-methoxy-4-(methoxymethyl)-11-methyl-8-methylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS | |
| (1R,4Z,9R)-4-(methoxymethyl)-11,11-dimethyl-8-methylidenebicyclo[7.2.0]undec-4-en-3-one | present | LOTUS | |
| (1R,4Z,9R,11S)-4,11-bis(hydroxymethyl)-11-methyl-8-methylidenebicyclo[7.2.0]undec-4-en-3-one | present | LOTUS | |
| (1R,5R,9R)-5-methoxy-11,11-dimethyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS | |
| (1R,5R,9R,11R)-5-hydroxy-11-(hydroxymethyl)-11-methyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS | |
| (1R,5R,9R,11S)-5-hydroxy-11-(hydroxymethyl)-11-methyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS | |
| (1R,5S,9R)-5-methoxy-11,11-dimethyl-4,8-dimethylidenebicyclo[7.2.0]undecan-3-one | present | LOTUS |
05DNA & barcoding20 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pulicaria dysenterica has left across the world's sequence archives.
At a glance
DNA specimens20
Marker genes5
GenBank sequences10
eDNA detections11
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Pulicaria dysenterica voucher EDNA20-0060160 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL3★ITS3★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Pulicaria dysenterica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 075 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Pulicaria dysenterica1.08 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–202n range18median18mode56records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1838×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BRULLO S., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:464-483.. Inform. Bot. Ital. , 10(2): 248-264.
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 245: 5-121(1971).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3995
CCDB · fl-europaea — Strid, 1971
CCDB · ipcn-api-dl — Pogan, E. 1983. Further studies in chromosome numbers of Polish angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57–77.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha. 1992. Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verh. Zool.-Bot. Ges. Wien 129: 215–226.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Snogerup, S. 1995. Mediterranean chromosome number reports 5 (491--517). Fl. Medit. 5: 331–334.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Dobea, C., M. Kiehn & E. Vitek. 1996. Beiträge zur Gefässpflanzen-Flora von Österreich: Chromosomenzählungen III. Verh. Zool.-Bot. Ges. Wien 133: 301–318.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Hommel, P. W. F. M. & J. H. Wieffering. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 277–278.
CCDB · ipcn-api-dl — Kuzmanova, B. & S. Georgieva. 1980. In Chromosome number reports LXIX. Taxon 29: 715.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — Van Loon, J. C. & H. C. M. Snelders. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632–634.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — GADELLA, T.W.J., & E. KLIPHUIS. 1973. Chromosome numbers of flowerinl plants in the Netherlands VI. Proc. Kon. Ned. Acad. Wet., ser. C 76: 303-311.
CCDB · book-ipcn73-74 — STRID, A. 1971. Chromosome numbers in some Albanian angiosperms. Bot. Notiser 124: 490-496.
CCDB · book-indian_vol1 — Fernandes, A. & Queiros, M. 1971; Strid, A. 1971 ; Hommel, P.W.F.M. & Wieffering, J.H. 1979; Van Loon, J. .4 Chr. & Snelders, H.C.M. 1979; Kuz- manov, B. & Georgieva, S. 1980
CCDB · eflora
CCDB · CromoCat 2015 — Brullo, S., Pavone, P. & Zizza, A. (1978d). Numeri cromosomici per la flora italiana: 506-516. Inf. Bot. Ital. 10: 397-405.
CCDB · CromoCat 2015 — Dobeš, C., Kiehn, M. & Vitek, E. (1996). Beiträge zur Gefässpflanzen-Flora von Österreich: Chromosomenzählungen III Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 133: 301-318
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1967). Chromosome numbers of flowering plants in the Netherlands. III. Proc. Kon. Ned. Akad. Wetensch. Ser. C 70(1): 7-20.
CCDB · CromoCat 2015 — Hommel, P. W. F. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIII]. Taxon 28(1, 2/3): 277-278.
CCDB · CromoCat 2015 — Loon van, J. C. & Snelders, H. M. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 627-637.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Morton, J. K. (1977). A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211-223.
CCDB · CromoCat 2015 — Pogan, E. & R. Jzmailow. (1983). Further studies in chromosome numbers of Polish Angiosperms. Part XVII. Acta Biol. Cracov., Ser. Bot. 25: 57-77.
CCDB · CromoCat 2015 — Snogerup, S. (1995b). Mediterranean chromosome number reports 5 (491--517). Fl. Medit. 5: 331-337.
CCDB · CromoCat 2015 — Vitek, E., M. Kiehn, K. Pascher, F. Starlinger, J. Greimler, U. Stocker, S. Lehner, P. Beinhofer & A. Blaha (1992). Beiträge zur Flora von Österreich---weitere Chromosomenzählungen. Verhandlungen der Zoologisch-botanischen Gesellschaft in Wien 129: 215-22
CCDB · CromoCat 2015 — Kuzmanov, B. & Georgieva, S. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 715.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
2n 2018×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +7
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Kochjarová J., 1992: Karyological study of the Slovak flora XXVIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 67-74.
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · fl-europaea — Majovsky et al.,
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-northern-plants — Rodolico 1933.
CCDB · book-indian_vol1 — Rodolico, A. 1933 ; Tischler, G. 1934; Murin & Vachova (Fedorov); Majovsk:Y, J. et a!. 1970a
CCDB · book-fedorov — Rodolico 1933
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Murin, Vachova
CCDB · book-fedorov — I. Slov. fl. I. .1967)
CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1967). Chromosome numbers of flowering plants in the Netherlands. III. Proc. Kon. Ned. Akad. Wetensch. Ser. C 70(1): 7-20.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 583-587.
CCDB · CromoCat 2015 — Rodolico, A. (1933). Appunti sulla cariologia e sull'embriologia delle Inuleae. Nuovo Giorn. Bot. Ital. 40: 421-425.
CCDB · CromoCat 2015 — Uhríková, A. & A. Murín. (1970). Reports (In Májovsky, J. & al. (ed.), Index of chromosome numbers of slovakian flora. Part 2). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 18: 45-60.
n 101×CCDB · ita-fl
CCDB · ita-fl — RODOLICO A. - 1933. Appunti sulla cariologia e sull'embriologia delle "Inuleae".. N. Giorn. Bot. Ital., n.s. , 40: 421-425.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97% BUSCO
08Occurrence & distribution
Record type234 970 records
Wild obs. + sensor231 785
Museum / vouchered2 689
Cultivated / captive17
Other479
Origin
Native19 772
Introduced31
Range
Area of Occupancy AOO198 232 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy30% within 1 km
≤100 m 24 480≤1 km 35 811≤10 km 137 407>10 km 1 482
199 180 georeferenced · 32 605 without coordinates
Open the mapobservation + sensor231 785
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 85≤1 km 338≤10 km 414>10 km 13
850 georeferenced · 1 839 without coordinates
Open the institutions mapphysical evidence2 689
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 6>10 km 10
16 georeferenced · 1 without coordinates
Open the mapnot free-living17
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 127 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 556 |
| Berlin, DE | 138 |
| LDlocation not on record | 121 |
| BRNUlocation not on record | 97 |
| València, ES | 88 |
| Salzburg, AT | 86 |
| Moscow State Universitylocation not on record | 76 |
| GJOlocation not on record | 66 |
| BFLlocation not on record | 56 |
| BDBClocation not on record | 46 |
| Vitoria, ES | 46 |
| MAlocation not on record | 39 |
| Barcelona, ES | 37 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 33 |
| South Kensington, GB | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 31 |
| Provincia di Livornolocation not on record | 31 |
| BClocation not on record | 29 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 28 |
| Adam Mickiewicz University in Poznańlocation not on record | 26 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 25 |
| Pamplona, ES | 24 |
| No collectionlocation not on record | 23 |
| Natural History Museum Rotterdamlocation not on record | 22 |
| San Sebastián, ES | 20 |
| Granada, ES | 20 |
| Bern, CH | 19 |
| Wlocation not on record | 18 |
| CJBGlocation not on record | 18 |
| Córdoba, ES | 17 |
| Phyletisches Museum Jenalocation not on record | 17 |
| Oskarshamn, SE | 17 |
| LfUlocation not on record | 15 |
| CICYTEXlocation not on record | 15 |
| Salamanca, ES | 14 |
| Dresden, DE | 13 |
| College of the Atlantic, Museumlocation not on record | 11 |
| Frauenfeld, CH | 11 |
| Görlitz, DE | 10 |
| Alicante, ES | 10 |
| Zürich, CH | 10 |
| Zürich, CH | 9 |
| PRClocation not on record | 9 |
| Jaén, ES | 9 |
| Entomological Society of Latvialocation not on record | 8 |
| Pamplona, ES | 8 |
| Mlocation not on record | 8 |
| ISAlocation not on record | 7 |
| DASSHlocation not on record | 7 |
| Paris, FR | 7 |
| Christchurch, NZ | 7 |
| Bourges, FR | 7 |
| SZUlocation not on record | 6 |
| Frankfurt am Main | 6 |
| Xiamen, CN | 5 |
| Kew, GB | 5 |
| Karlsruhe, DE | 5 |
| MeiseBGlocation not on record | 5 |
| Winterthur, CH | 5 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Auckland, NZ | 4 |
| Tilburg, NL | 4 |
| Porrentruy, CH | 3 |
| Madrid, ES | 3 |
| Brussel, BE | 3 |
| Nijmegen, NL | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Sevilla, ES | 3 |
| Banyoles, ES | 3 |
| H-AkrKGlocation not on record | 3 |
| BSBIlocation not on record | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Glarus, CH | 3 |
| Museo Achille Folettolocation not on record | 3 |
| University of Stellenboschlocation not on record | 3 |
| EEZA-CSIClocation not on record | 2 |
| Uppsala, SE | 2 |
| National Museum Waleslocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Sion, CH | 2 |
| JBSlocation not on record | 2 |
| Wellington, NZ | 2 |
| Coimbra, PT | 2 |
| Badajoz, ES | 2 |
| Monastir, TN | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| Rotorua, NZ | 2 |
| Salvador, BR | 1 |
| Stockholm, SE | 1 |
| Hazara Universitylocation not on record | 1 |
| Corrientes, AR | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Saint Louis, US | 1 |
| H-Hohlalocation not on record | 1 |
| München, DE | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Lausanne, CH | 1 |
| Olocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| CASlocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| CBDClocation not on record | 1 |
| Namur, BE | 1 |
| BGBMlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| FLADlocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Gijón, ES | 1 |
| Taipei, TW | 1 |
| San Francisco, US | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Musee National d'histoire Naturelle Luxembourglocation not on record | 1 |
| UIBlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Québec, CA | 1 |
| Rishon Le Zion, IL | 1 |
| EL PASO, US | 1 |
| Göteborg, SE | 1 |
| Wuzhou, CN | 1 |
| Oswego, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Canberra, AU | 1 |
| Palmerston North, NZ | 1 |
| Fulda, DE | 1 |
| DBF-NHMDlocation not on record | 1 |
127 institutions · 2 250 of 2 689 vouchered records shown · 437 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Pulicaria dysenterica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.3 °C 12.8–17.9
Seasonal swing summer↔winter14.1 °C
Max temp (day)21.2 °C 15.0–22.1
Min temp (night)13.5 °C 9.80–13.6
Precipitation77.0 mm/mo 56.7–89.7
Air humidity61.4 % 59.7–63.3
Moisture balance-27.5 mm/mo
Vapour deficit773 Pa 582–830
Wind speed3.50 m/s
Cloud cover41.7 % 35.0–50.2
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.