Puccinia xanthii

Schwein. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records2 321

Data sources8

Biological traits0

DNA specimens4

eDNA detections4

Sources8 archives

Databases and archives Puccinia xanthii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility2 321 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 321 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Puccinia xanthii is a plant pathogen infecting sunflowers. It also causes rust on Xanthium occidentale and can be used as a form of biological control where this plant is an invasive species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia xanthii has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences8

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ482649.1 ↗396 bpIndia

ACGT

TCTCTAGGCTCTCATATCGATGAAGAACACAGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAACG …

Puccinia xanthii strain BAB1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS8

fungal barcode

08Occurrence & distribution

Record type2 321 records

Wild obs. + sensor36

Museum / vouchered2 072

Other213

Range

Area of Occupancy AOO3 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 21≤1 km 5>10 km 2

28 georeferenced · 8 without coordinates

Open the mapobservation + sensor36

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 2≤1 km 83≤10 km 1 094>10 km 365

1 544 georeferenced · 528 without coordinates

Open the institutions mapphysical evidence2 072

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	614
DPIlocation not on record	262
ILLSlocation not on record	214
Madison, US	165
Champaign, US	99
Bronx, US	95
Catholic University of Pekinglocation not on record	82
Lincoln, US	64
Chicago, US	61
Brown Universitylocation not on record	60
FLASlocation not on record	58
Chapel Hill, US	49
Pullman, US	33
St. Paul, US	25
TENN-Flocation not on record	25
McWane Science Centerlocation not on record	23
Laramie, US	19
PHlocation not on record	18
Clemson, US	14
Museu Paraense Emílio Goeldilocation not on record	14
Baton Rouge, US	12
Academy of Sciences of the Republic of Uzbekistanlocation not on record	10
Ann Arbor, US	9
Toronto, CA	7
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	6
Museo Entomologico de Leonlocation not on record	5
Museum of Zoologylocation not on record	5
WU-MYClocation not on record	5
BISHlocation not on record	3
Helsinki, FI	3
Honolulu, US	3
Cincinnati, US	3
Kensington, AU	2
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
Karlsruhe, DE	1
Hobart, AU	1
Bando, JP	1
CA	1

38 institutions · 2 072 of 2 072 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Puccinia xanthii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Puccinia xanthii

At a glance

Sources8 archives

At a glance

Record type2 321 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 321 records