Puccinia recondita

Roberge ex Desm. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records5 109

Data sources9

Biological traits0

DNA specimens86

eDNA detections101

Sources9 archives

Databases and archives Puccinia recondita's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 108 records↗

OBISOcean Biodiversity Information System1 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI101 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics86 specimens↗

GoaTGenomes on a Tree · Sangergenome ~0.13 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS5 109 records

Environmental DNA2 datasets · 3 countries101 detections

DNA & barcodingBOLD86 specimens

Genome at a glanceGoaT128 Mbp

01Narrative

Wheat leaf rust (Puccinia triticina) is a fungal disease that affects wheat, barley, rye stems, leaves and grains. In temperate zones it is destructive on winter wheat because the pathogen overwinters. Infections can lead up to 20% yield loss, which is exacerbated by dying leaves, which fertilize the fungus. The pathogen is a Puccinia rust fungus. It is the most prevalent of all the wheat rust diseases, occurring in most wheat-growing regions. It causes serious epidemics in North America, Mexico and South America and is a devastating seasonal disease in India. P. triticina is heteroecious, requiring two distinct hosts (alternate hosts).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding86 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia recondita has left across the world's sequence archives.

At a glance

DNA specimens86

Marker genes4

eDNA detections101

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P335 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes1

BINs0

Where individuals differ — all 1 variable positions, in barcode order

111Amostly conserved

GCTAAGGATATTGCCATTCTATATTTTGTATTTGGGCTATTTTCAGCACTTCTAGGGACAGGGATATCGATTCTGATTAGACTAGAGCTA …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS★ITS1★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Puccinia recondita carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size128 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Puccinia recondita0.13 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type5 109 records

Wild obs. + sensor744

Museum / vouchered4 284

Other81

Origin

Native8

Range

Area of Occupancy AOO10 092 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 125≤1 km 79≤10 km 442>10 km 12

658 georeferenced · 86 without coordinates

Open the mapobservation + sensor744

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 17≤1 km 219≤10 km 1 857>10 km 360

2 453 georeferenced · 1 831 without coordinates

Open the institutions mapphysical evidence4 284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions24 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Madison, US	962
ILLSlocation not on record	753
Bronx, US	710
Bernard Price Institute for Palaeontological Researchlocation not on record	426
DPIlocation not on record	377
Auckland, NZ	158
Helsinki, FI	154
Laramie, US	109
TENN-Flocation not on record	77
Pullman, US	77
Görlitz, DE	70
Karlsruhe, DE	60
St. Paul, US	51
Museo Entomologico de Leonlocation not on record	29
Durham, US	28
Catholic University of Pekinglocation not on record	28
LDlocation not on record	27
CA	25
McWane Science Centerlocation not on record	18
Bando, JP	16
Kensington, AU	14
Uppsala, SE	13
Stockholm, SE	12
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	10
MAlocation not on record	9
Kew, GB	8
Champaign, US	7
University of Tennessee at Chattanoogalocation not on record	5
PHlocation not on record	5
Adelaide, AU	5
Hobart, AU	4
Toronto, CA	4
WU-MYClocation not on record	4
IFR-DNFlocation not on record	3
Canberra, AU	3
Copenhagen, DK	3
GZUlocation not on record	2
Academy of Sciences of the Republic of Uzbekistanlocation not on record	2
GJOlocation not on record	2
Oskarshamn, SE	1
SLU Artdatabankenlocation not on record	1
FLASlocation not on record	1
San Diego, US	1
BRNUlocation not on record	1

44 institutions · 4 275 of 4 284 vouchered records shown · 8 without an institution code

09Environmental DNA101 detections

Where the DNA of Puccinia recondita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found101

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 101 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.0 °C 11.0–24.0

pH6.50 5.20–7.00

Conductivity118 µS/cm 21.0–247

Organic carbon3.85 % 0.51–5.07

Nitrate-N10.0 mg/kg 2.00–55.0

Phosphorus35.0 mg/kg 7.00–130

Clay15.0 % 4.20–41.1

Sand72.5 % 27.1–86.8

Depth0 m 0–0.2

SoilTenosolVertosolKurosolFerrosolLatLon out of range

23 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.8 °C 12.7–16.3

Seasonal swing summer↔winter13.8 °C

Max temp (day)19.4 °C 16.6–22.4

Min temp (night)8.60 °C 8.20–10.6

Precipitation56.0 mm/mo 54.3–58.9

Air humidity56.3 % 54.8–57.4

Moisture balance-75.2 mm/mo -105–-67.3

Vapour deficit695 Pa 622–837

Wind speed3.60 m/s 2.90–4.00

Cloud cover25.9 % 23.7–40.0

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Puccinia recondita

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type5 109 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions24 of 44 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type5 109 records