Puccinia pseudostriiformis

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records14

Data sources4

Biological traits0

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Puccinia pseudostriiformis's data was compiled from.

GBIFGlobal Biodiversity Information Facility14 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF14 records

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia pseudostriiformis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHM057134.1 ↗275 bpUSA · 1956

ACGT

TTCAGTGATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCAAAAGGCACACGTTTGAGTGTCATGAAACCCTCTCATTAAA …

Puccinia pseudostriiformis strain PUR N5354 5.8S ribosomal RNA gene, partial sequence; and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS7

fungal barcode

08Occurrence & distribution

Record type14 records

Wild obs. + sensor11

Museum / vouchered3

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 6

11 georeferenced

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vancouver, CA	1
San Sebastián, ES	1
Karlsruhe, DE	1

3 institutions · 3 of 3 vouchered records shown