Puccinia oxalidis

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records1 420

Data sources8

Biological traits0

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Puccinia oxalidis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 420 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.35 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 420 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT355 Mbp

01Narrative

Puccinia oxalidis is a fungus species in the genus Puccinia. This species is a causal agent of rust on plants in the genus Oxalis, such as Oxalis articulata. The disease appears as yellow dots on the reverse of the leaves. The aecial stage can be found on Berberis repens.Aecial Stage of Puccinia oxalidis. W. H. Long and R. M. Harsch, Botanical Gazette, May 1918, volume 65, Number 5, pages 475-478,

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia oxalidis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPV619489.1 ↗308 bpChina · 2023

ACGT

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATAAAAAATAAGAGTGCACTTTATTGTGGCTCAAACTTTTTTAC …

Puccinia oxalidis strain XJ_ITS1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Puccinia oxalidis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size354 900 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Puccinia oxalidis0.35 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 420 records

Wild obs. + sensor909

Museum / vouchered504

Other7

Origin

Introduced2

Range

Area of Occupancy AOO3 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 388≤1 km 60≤10 km 216>10 km 48

712 georeferenced · 197 without coordinates

Open the mapobservation + sensor909

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 19≤1 km 26≤10 km 95>10 km 50

190 georeferenced · 314 without coordinates

Open the institutions mapphysical evidence504

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	114
DPIlocation not on record	106
Auckland, NZ	84
FLASlocation not on record	23
Kew, GB	23
Helsinki, FI	22
Bronx, US	22
Catholic University of Pekinglocation not on record	15
Madison, US	13
Chicago, US	12
Odawara, JP	9
Durango, MX	9
Karlsruhe, DE	7
Champaign, US	5
TENN-Flocation not on record	5
Baton Rouge, US	4
Museo Entomologico de Leonlocation not on record	4
Zapopan, MX	4
Pullman, US	4
Kensington, AU	3
Bando, JP	3
Hobart, AU	2
Brown Universitylocation not on record	1
ISAlocation not on record	1
Gijón, ES	1
Leicester, GB	1
Laramie, US	1
Uppsala, SE	1
PHlocation not on record	1
San Sebastián, ES	1

30 institutions · 501 of 504 vouchered records shown · 3 without an institution code

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type1 420 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 30 geolocated

Record type1 420 records