Puccinia monoica

(Peck) Arthur · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records1 045

Data sources8

Biological traits0

DNA specimens11

eDNA detections8

Sources8 archives

Databases and archives Puccinia monoica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility1 045 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 045 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD · NCBI11 specimens

01Narrative

Puccinia monoica is a parasitic rust fungus of the genus Puccinia that inhibits flowering in its host plant (usually a Boechera species) and radically transforms host morphology in order to facilitate its own sexual reproduction.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia monoica has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes2

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSHQ317543.1 ↗288 bpCanada · 1998

ACGT

ATCATTGAATCTTTGAACGCACCTTGCACCTTTTGGTATTCCAAAAGGTACACCTGTTTGAGTGTCATGAAACCCTCTCATAAAAATAAT …

Puccinia monoica strain DAOM 226360 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type1 045 records

Wild obs. + sensor739

Museum / vouchered284

Other22

Range

Area of Occupancy AOO2 916 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 441≤1 km 75≤10 km 24>10 km 31

571 georeferenced · 168 without coordinates

Open the mapobservation + sensor739

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 41≤10 km 130>10 km 39

210 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	86
Pullman, US	45
Madison, US	45
Bronx, US	31
TENN-Flocation not on record	18
Laramie, US	13
Brown Universitylocation not on record	9
CA	6
Durham, US	5
Cincinnati, US	5
Lincoln, US	5
California State University, East Baylocation not on record	3
Vancouver, CA	2
Kew, GB	2
McWane Science Centerlocation not on record	2
St. Paul, US	2
Catholic University of Pekinglocation not on record	2
Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
Helsinki, FI	1
PHlocation not on record	1

20 institutions · 284 of 284 vouchered records shown

09Environmental DNA8 detections

Where the DNA of Puccinia monoica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.80 °C 5.80–9.20

Seasonal swing summer↔winter16.9 °C

Max temp (day)13.0 °C 13.0–16.0

Min temp (night)-0.4 °C -0.4–2.40

Precipitation60.2 mm/mo 50.3–60.2

Air humidity44.2 % 44.2–50.7

Moisture balance-61.5 mm/mo -81.6–-61.5

Vapour deficit522 Pa 522–581

Wind speed2.70 m/s 2.10–2.70

Cloud cover34.8 % 34.8–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Puccinia monoica

At a glance

Sources8 archives

At a glance

Record type1 045 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 045 records