Puccinia liliacearum

Duby · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records784

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Puccinia liliacearum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility784 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF784 records

DNA & barcodingNCBIsequences

01Narrative

Puccinia liliacearum is a rust on Ornithogalum species. It is a microcyclic species lacking aecia and uredinia. It was described from Ornithogalum umbellatum in France, and it is common in Europe and Asia. It has been introduced to North America. In the United States of America, the first records are from New York in 1971 and Pennsylvania in 1972. It has since spread south to Maryland and east to Indiana. Close-up of black telia on an infected leaf of Ornithogalum umbellatum

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia liliacearum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSKX260148.1 ↗1 430 bp

ACGT

TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCCTTTTGGTATTCCAAAAGGCACACCTGTTTGAGTGTCATGAAACC …

Puccinia liliacearum voucher BPI:872279 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type784 records

Wild obs. + sensor518

Museum / vouchered258

Other8

Range

Area of Occupancy AOO1 772 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 156≤1 km 11≤10 km 267>10 km 15

449 georeferenced · 69 without coordinates

Open the mapobservation + sensor518

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 5≤1 km 9≤10 km 34>10 km 7

55 georeferenced · 203 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Görlitz, DE	121
Bernard Price Institute for Palaeontological Researchlocation not on record	23
WU-MYClocation not on record	22
Karlsruhe, DE	21
Bronx, US	8
LDlocation not on record	8
Kew, GB	7
Pullman, US	6
DPIlocation not on record	4
Berlin, DE	3
Chicago, US	3
Museo Entomologico de Leonlocation not on record	3
TROMlocation not on record	3
Stockholm, SE	2
Champaign, US	2
MeiseBGlocation not on record	2
McWane Science Centerlocation not on record	2
Cincinnati, US	1
Ann Arbor, US	1
TENN-Flocation not on record	1
GJOlocation not on record	1
nsnflocation not on record	1
Mlocation not on record	1
Chapel Hill, US	1

24 institutions · 247 of 258 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)