Puccinia horiana

Henn. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records222

Data sources10

Biological traits0

DNA specimens94

eDNA detections92

Sources10 archives

Databases and archives Puccinia horiana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility222 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics94 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF222 records

Environmental DNA1 datasets · 5 countries92 detections

DNA & barcodingBOLD · NCBI94 specimens

Genome at a glanceGoaT · NCBI≈66 Mbp

01Narrative

Puccinia horiana is a species of fungus that causes chrysanthemum white rust, is a disease of plant species of the genus Chrysanthemum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding94 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia horiana has left across the world's sequence archives.

At a glance

DNA specimens94

Marker genes1

GenBank sequences10

eDNA detections92

Countries7

The DNA barcodea real sequence read deposited for this species

ITSEU014028.1 ↗730 bpJapan

ACGT

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCTGTAGGTGAACCTGCAGAAGGATCATTATTAAAAGAACTAGAGTGCACTT …

Puccinia horiana isolate R56J clone 08 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Puccinia horiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈66 403 143 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Puccinia horiana0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness90.7% BUSCO

08Occurrence & distribution

Record type222 records

Wild obs. + sensor24

Museum / vouchered198

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 8≤1 km 2≤10 km 13

23 georeferenced · 1 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 1≤1 km 7≤10 km 7>10 km 2

17 georeferenced · 181 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	77
Auckland, NZ	17
Bernard Price Institute for Palaeontological Researchlocation not on record	15
Görlitz, DE	4
Kensington, AU	3
Karlsruhe, DE	3
Odawara, JP	2
Kew, GB	2
Catholic University of Pekinglocation not on record	2
Mlocation not on record	1
Chapel Hill, US	1
Pullman, US	1
Leicester, GB	1
ILLSlocation not on record	1
Uppsala, SE	1
Canberra, AU	1

16 institutions · 132 of 198 vouchered records shown · 40 without an institution code

09Environmental DNA92 detections

Where the DNA of Puccinia horiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.1 °C 7.40–10.1

Seasonal swing summer↔winter12.8 °C

Max temp (day)11.8 °C 9.60–13.4

Min temp (night)7.90 °C 3.00–7.90

Precipitation93.6 mm/mo 65.2–344

Air humidity63.4 % 62.8–64.9

Moisture balance22.4 mm/mo -26.0–263

Vapour deficit469 Pa 428–487

Wind speed4.80 m/s 2.90–5.10

Cloud cover47.3 % 42.0–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)