Puccinia hordei

G.H.Otth · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records1 135

Data sources9

Biological traits0

DNA specimens40

eDNA detections86

Sources9 archives

Databases and archives Puccinia hordei's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 135 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 135 records

Environmental DNA5 datasets · 6 countries86 detections

DNA & barcodingBOLD · NCBI40 specimens

Genome at a glanceGoaT · NCBI180 Mbp

01Narrative

Puccinia hordei is a species of rust fungus. A plant pathogen, it can cause barley brown rust.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia hordei has left across the world's sequence archives.

At a glance

DNA specimens40

Marker genes4

GenBank sequences10

eDNA detections86

Countries12

The DNA barcodea real sequence read deposited for this species

ITSPQ308975.1 ↗281 bp

ACGT

ATCATCGAATCTTTGAACGCATCTTGCGCCTTTTGGTATTCCAAAAGGCACACCTGTTTGAGTGTCATGAAACCCTCTCATTAAACCATT …

Puccinia hordei isolate YN1949301 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1★ITS2

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Puccinia hordei carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size179 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Puccinia hordei0.18 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness89.1% BUSCO

08Occurrence & distribution

Record type1 135 records

Wild obs. + sensor245

Museum / vouchered873

Other17

Origin

Native11

Range

Area of Occupancy AOO2 812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 26≤1 km 29≤10 km 182

237 georeferenced · 8 without coordinates

Open the mapobservation + sensor245

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 1≤1 km 48≤10 km 134>10 km 34

217 georeferenced · 656 without coordinates

Open the institutions mapphysical evidence873

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	96
Bernard Price Institute for Palaeontological Researchlocation not on record	68
DPIlocation not on record	64
Auckland, NZ	59
Bronx, US	33
Karlsruhe, DE	25
MAlocation not on record	19
Helsinki, FI	17
Görlitz, DE	16
LDlocation not on record	11
Kew, GB	9
Madison, US	8
Olocation not on record	8
Museo Entomologico de Leonlocation not on record	7
Academy of Sciences of the Republic of Uzbekistanlocation not on record	6
Chicago, US	5
Pullman, US	4
WU-MYClocation not on record	3
Copenhagen, DK	3
Mlocation not on record	3
Catholic University of Pekinglocation not on record	2
St. Paul, US	2
Champaign, US	2
CA	2
Kensington, AU	2
University of Tennessee at Chattanoogalocation not on record	2
Baton Rouge, US	1
Trondheim, NO	1
Canberra, AU	1
Uppsala, SE	1
BDBClocation not on record	1
San Sebastián, ES	1
Stockholm, SE	1

33 institutions · 483 of 873 vouchered records shown · 389 without an institution code

09Environmental DNA86 detections

Where the DNA of Puccinia hordei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys5

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH6.60 3.80–8.76

Conductivity57.0 µS/cm 19.0–2,600

Organic carbon2.40 % 0.015–5.10

Water content6.48 % 5.00–48.8

Nitrate-N5.00 mg/kg 2.00–190

Phosphorus17.0 mg/kg 3.00–130

Clay18.9 % 1.89–67.0

Sand70.2 % 0–96.1

Depth0.2 m 0–0.2

SoilChromosolsDermosolFerrosolSodosolLatLon out of rangeTenosol

58 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 12.2–26.1

Seasonal swing summer↔winter13.1 °C

Max temp (day)19.7 °C 17.1–27.8

Min temp (night)10.4 °C 7.90–24.1

Precipitation58.2 mm/mo 32.8–602

Air humidity58.2 % 54.8–65.8

Moisture balance-42.1 mm/mo

Vapour deficit713 Pa 593–1,148

Wind speed3.40 m/s

Cloud cover25.8 % 12.9–58.1

CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Puccinia hordei

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 135 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 33 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 135 records