Puccinia arachidis

Speg. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Pucciniaceae/Puccinia

At a glance

Occurrence records88

Data sources9

Biological traits0

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Puccinia arachidis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF88 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT · NCBI≈88 Mbp

01Narrative

Puccinia arachidis, or peanut rust, is a plant pathogen that causes rust on peanut. Its spread is promoted by warm, damp weather.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition8 compounds

Compounds documented for Puccinia arachidis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols4

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
Melibentin	present	NPASS
Melisimplexin	present	NPASS
Melisimplin	present	NPASS
Meliternatin	present	NPASS
Methyl 2-(3,7-dimethylocta-2,6-dienoxy)-4,6-dihydroxy-3-(hydroxymethyl)benzoate	present	NPASS
Methyl 2-(3,7-dimethylocta-2,6-dienoxy)-6-hydroxy-3-(hydroxymethyl)-4-methoxybenzoate	present	NPASS
UXUQTRQPUOUNQT-MDWZMJQESA-N	present	NPASS
YKIAOKGXYJGHEC-NTEUORMPSA-N	present	NPASS

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Puccinia arachidis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR470005.1 ↗416 bpChina

ACGT

AGTGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATTGAATCTTTGAATGCACCTTGCACCTTTTGGTATTCCAGAAGGT …

Puccinia arachidis voucher HGUP21200 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Puccinia arachidis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈87 617 276 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Puccinia arachidis0.09 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

Completeness18.5% BUSCO

08Occurrence & distribution

Record type88 records

Wild obs. + sensor3

Museum / vouchered85

Range

Area of Occupancy AOO272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤1 km 3≤10 km 26>10 km 11

41 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	39
DPIlocation not on record	21
Auckland, NZ	12
University of Parakoulocation not on record	2
LSU, UNIPARlocation not on record	2
Catholic University of Pekinglocation not on record	2
Paris, FR	1
Museu Paraense Emílio Goeldilocation not on record	1
Museum of Zoologylocation not on record	1
Museo de La Platalocation not on record	1
Madison, US	1
Durango, MX	1

12 institutions · 84 of 85 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)