Pterygotrigla polyommata

(Richardson, 1839) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Triglidae/Pterygotrigla

At a glance

Occurrence records24 156

Data sources12

Biological traits7

DNA specimens13

eDNA detections11

Sources12 archives

Databases and archives Pterygotrigla polyommata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 817 records↗

OBISOcean Biodiversity Information System12 339 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

FooDBThe Metabolomics Innovation Centrecompounds↗

foodatlascompounds

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.80 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Chemical compositionFooDB · FoodAtlas108 compounds

Occurrence & distributionGBIF · OBIS24 156 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD13 specimens

Genome at a glanceGoaT802 Mbp

01Narrative

Pterygotrigla polyommata, the latchet, butterfly gurnard, flying gurnard, lachet gurnard, pastry, sharpbeak gurnard, spiny gurnard or spinybeak gurnard, is a species of marine ray-finned fish belonging to the family Triglidae, the gurnards and sea robins. It is found in the southeastern Indian and southwestern Pacific Oceans.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length62 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max300 m

Depth min18 m

Vulnerability44.8

03Chemical composition108 compounds

Compounds documented for Pterygotrigla polyommata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingConfectioneries

Compound class profile5 classes

Aminoacids1 022

Pyridine alkaloids253

pteridine alkaloids229

Branched fatty acids $ Unsaturated fatty acids162

Unsaturated fatty acids161

Documented compounds108 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Sugars		49,600 mg/100g	FooDB
α-D-galactose		44,500 mg/100g	FooDB

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterygotrigla polyommata has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.31%

Haplotypes2

BIN1

Most divergent pair0.61%

Where individuals differ — all 7 variable positions, in barcode order

172Gmostly conserved

205Gmostly conserved

454Cmostly conserved

505Tmostly conserved

535Cmostly conserved

538Tmostly conserved

580Gmostly conserved

CCTGTATCTAGTATTTGGTGCCTGAGCTGGAATAGTAGGAACGGCCTTAAGCCTCCTCATTCGGGCAGAACTAAGCCAACCTGGCGCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pterygotrigla andertonisame genus6.5%Pterygotrigla paulisame genus6.6%Pterygotrigla hemistictasame genus10.4%Pterygotrigla ryukyuensissame genus11.3%Trigla lyrasame family13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Pterygotrigla polyommata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size801 960 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pterygotrigla polyommata0.80 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type24 156 records

Wild obs. + sensor15 884

Museum / vouchered790

Other7 482

Origin

Native1

Range

Area of Occupancy AOO9 332 km²

Depth

0–200 m sunlit7 061

200–1000 m twilight316

1–4 km midnight0

>4 km abyssal0

median 103.5 m · max 540 m · 7 377 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 121≤1 km 6 654≤10 km 756>10 km 8 347

15 878 georeferenced · 6 without coordinates

Open the mapobservation + sensor15 884

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy63% within 1 km

≤100 m 58≤1 km 230≤10 km 116>10 km 56

460 georeferenced · 330 without coordinates

Open the institutions mapphysical evidence790

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	110
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	60
Museums Victorialocation not on record	52
Sydney, AU	41
Tasmanian Museum & Art Gallerylocation not on record	16
Western Australian Museumlocation not on record	14
	4
QVMAGlocation not on record	3
CSIRO, Australian National Fish Collectionlocation not on record	3
Natick, US	2
CASlocation not on record	2
Paris, FR	1
Cambridge, US	1
Museum and Art Gallery of the Northern Territorylocation not on record	1
FishBaselocation not on record	1
Los Angeles, US	1

16 institutions · 312 of 790 vouchered records shown · 10 without an institution code

09Environmental DNA11 detections

Where the DNA of Pterygotrigla polyommata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 12.0–19.2

Seasonal swing summer↔winter6.10 °C

Max temp (day)18.1 °C 13.0–20.2

Min temp (night)16.2 °C 11.1–18.2

Precipitation57.5 mm/mo 27.6–85.7

Air humidity60.1 % 58.3–61.7

Vapour deficit790 Pa 568–860

Cloud cover25.2 % 20.9–30.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pterygotrigla polyommata

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

Compound class profile5 classes

Documented compounds108 total

At a glance

Genome sizehow big the whole instruction manual is

Record type24 156 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type24 156 records