Pterulicium xylogenum

(Berk. & Broome) Corner · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Pterulaceae/Pterulicium

At a glance

Occurrence records21

Data sources6

Biological traits0

DNA specimens0

eDNA detections6

Sources6 archives

Databases and archives Pterulicium xylogenum's data was compiled from.

GBIFGlobal Biodiversity Information Facility21 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF21 records

Environmental DNA3 datasets · 2 countries6 detections

DNA & barcodingNCBIsequences

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterulicium xylogenum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPX914286.1 ↗523 bpChina · 2024

ACGT

TCGCTGCTGGCTCTCCGGAGCATGTGCACGCCTCTCACACTTTATTCAACCACCTGTGCATCTCCTGTAGTCTCTCAGACGCCTTTCAAT …

Pterulicium xylogenum isolate WFH137 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type21 records

Wild obs. + sensor10

Museum / vouchered11

Range

Area of Occupancy AOO44 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 4≤1 km 1>10 km 2

7 georeferenced · 3 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤1 km 3≤10 km 7

10 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of the Philippines Los Baños Museum of Natural Historylocation not on record	7
Bernard Price Institute for Palaeontological Researchlocation not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1

3 institutions · 11 of 11 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Pterulicium xylogenum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 19.4–24.0

Seasonal swing summer↔winter3.50 °C

Max temp (day)26.2 °C 22.6–26.2

Min temp (night)21.2 °C 16.5–22.0

Precipitation181 mm/mo 110–181

Air humidity74.2 % 61.1–74.2

Moisture balance8.80 mm/mo -26.1–8.80

Vapour deficit753 Pa 735–926

Wind speed4.10 m/s 2.30–4.10

Cloud cover25.4 % 25.4–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)