Pterostylis baptistii

Fitzg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pterostylis

At a glance

Occurrence records750

Data sources7

Biological traits30

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Pterostylis baptistii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility750 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources30 traits

Occurrence & distributionGBIF750 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

In Bongil Bongil National Park Pterostylis baptistii, commonly known as the king greenhood, is a species of orchid endemic to eastern Australia. Flowering plants have a rosette of stalked, dark green leaves and a single white flower with green and brown markings, and a wide gap between the petals and lateral sepals. It occurs mostly in New South Wales but is also found in coastal Queensland and north-eastern Victoria.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length55 mm

Leaf length max80 mm

Leaf length min10 mm

Leaf width22.5 mm

Leaf width max25 mm

Leaf width min15 mm

Plant height0.4 m

Plant height max0.4 m

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnyyyynn

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeoblong ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterostylis baptistii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSGQ405647.1 ↗679 bp

ACGT

ATCATTGTCGAGACCCTGAAAGGATTGGATGACCTTTGATAACATGTGAGCAGGGGGCGGCGGCAGCTGCCTGTAAACACCATCCATCCG …

Pterostylis baptistii internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type750 records

Wild obs. + sensor338

Museum / vouchered409

Cultivated / captive3

Origin

Native96

Range

Area of Occupancy AOO1 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 130≤1 km 53≤10 km 18>10 km 119

320 georeferenced · 18 without coordinates

Open the mapobservation + sensor338

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 9≤1 km 38≤10 km 308>10 km 22

377 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence409

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	96
Canberra, AU	96
Brisbane, AU	95
Museo Entomologico de Leonlocation not on record	38
Smithfield, AU	29
Adelaide, AU	18
Armidale, AU	17
Hobart, AU	7
Kensington, AU	2
Batemans Bay, AU	2
Madison, US	2
QVMAGlocation not on record	2
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Christchurch, NZ	1

16 institutions · 408 of 409 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pterostylis baptistii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)