Pterostylis auriculata

Colenso · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pterostylis

At a glance

Occurrence records187

Data sources9

Biological traits9

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Pterostylis auriculata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility187 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF187 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Pterostylis auriculata is a species of orchid endemic to New Zealand. Unlike many other greenhood orchids, this species lacks a rosette of leaves but instead only has leaves on the flowering stem. All parts of the plant are glossy and there is a single green flower with a reddish tinge.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterostylis auriculata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSGQ866351.1 ↗687 bp

ACGT

ATCATTGTCGAGACCCTGAAAGGATTGGATGACCTTTGACAACATGTGAGCAGGGGGCGGCGACAGCTGCCTGTAAACCCCTTCCATCCG …

Pterostylis auriculata voucher B Molloy 224/00 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pterostylis auriculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 441×CCDB · new-zealand

CCDB · new-zealand

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type187 records

Wild obs. + sensor153

Museum / vouchered34

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 58≤1 km 35≤10 km 21>10 km 13

127 georeferenced · 26 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the institutions mapphysical evidence34

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	33
Wellington, NZ	1

2 institutions · 34 of 34 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Pterostylis auriculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)