Pterostylis atrans

D.L.Jones · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pterostylis

At a glance

Occurrence records487

Data sources6

Biological traits25

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Pterostylis atrans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility487 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF487 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Pterostylis atrans, commonly known as the dark-tip greenhood or blunt-tongue greenhood, is a species of orchid endemic to south-eastern Australia. As with similar greenhoods, plants in flower differ from those that are not flowering. The non-flowering plants have a rosette of leaves flat on the ground, but the plants in flower have a single flower with leaves on the flowering spike. In this species, the flower is green and reddish brown with a protruding sinus and small club-like tips on the ends of the lateral sepals.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology4

Leaf length22.5 mm

Leaf width15 mm

Plant height0.3 m

Plant height max0.3 m

Life cycle & reproduction8

Dispersal typewind

Flowering timenyyyyynnnnnn

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapelanceolate oblong ovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterostylis atrans has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ866275.1 ↗692 bp

ACGT

ATCATTGTCGAGACCCTGAAAGGATTGAATGACCTTTGATAACATGTGAGCAGGGGCGGCAACAGCTGTCTGTAAACACCGTCCATCTGT …

Diplodium atrans voucher KJ FitzGerald 112 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type487 records

Wild obs. + sensor256

Museum / vouchered231

Origin

Native8

Introduced1

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 61≤1 km 73≤10 km 85>10 km 17

236 georeferenced · 20 without coordinates

Open the mapobservation + sensor256

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 5≤1 km 81≤10 km 111>10 km 17

214 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	95
Canberra, AU	88
Hobart, AU	23
QVMAGlocation not on record	9
Mount Annan, AU	8
Adelaide, AU	8

6 institutions · 231 of 231 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Pterostylis atrans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)