Pterostylis allantoidea

R.S.Rogers · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Pterostylis

At a glance

Occurrence records64

Data sources7

Biological traits18

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Pterostylis allantoidea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility64 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF64 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Pterostylis allantoidea, commonly known as the shy greenhood, is a species of orchid which is endemic to the south-west of Western Australia. It has a large rosette of leaves at the base of a flowering spike and a single white flower with green or reddish-brown stripes.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology3

Plant height0.09 m

Plant height max0.1 m

Plant height min0.08 m

Life cycle & reproduction5

Flowering timennnnnnnyynnn

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterostylis allantoidea has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences8

eDNA detections7

The DNA barcodea real sequence read deposited for this species

ITSGQ866333.1 ↗682 bp

ACGT

CATTGTCGAGACCCTGAAAGGATTGAATGACCTTTGATAACATGTGAGCAAGGGCGGCGACAGTCGTCTGTAAACACCGTCCATCTGTTG …

Eremorchis allantoidea voucher MA Clements 10928b internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS6★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type64 records

Wild obs. + sensor4

Museum / vouchered59

Cultivated / captive1

Origin

Native2

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 1≤10 km 1>10 km 1

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 18≤1 km 9≤10 km 23>10 km 4

54 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence59

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	25
Canberra, AU	22
Museo Entomologico de Leonlocation not on record	4
Adelaide, AU	4
Mount Annan, AU	2
Brisbane, AU	1
BGPAlocation not on record	1

7 institutions · 59 of 59 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA7 detections

Where the DNA of Pterostylis allantoidea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)