Pterospermum suberifolium

(L.) Lam. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Pterospermum

At a glance

Occurrence records35

Data sources9

Biological traits13

DNA specimens7

eDNA detections4

Sources9 archives

Databases and archives Pterospermum suberifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility35 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF35 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 38

01Narrative

Pterospermum suberifolium, or the cork-leaved bayur, is a species of evergreen flowering plant in the family Malvaceae. It is found only in India and Sri Lanka. Leaves are irregularly oblong; subcordate, rounded or oblique; apex acuminate; with irregularly serrated margin. Its flowers are yellowish white and fruit is a capsule. A famous nagaraja in Buddhism is named for the fruit of the P. suberifolium, mucalinda.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Leaf size4 213 mm²

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree (T)

Woodinesswoody

Physiology & chemistry5

Leaf C:N ratio31.28 g/g

Leaf dry-matter content (LDMC)424 mg/g

Leaf n20.3 mg/g

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)9.18 mm²/mg

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterospermum suberifolium has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes3

GenBank sequences3

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON130108.1 ↗484 bp

ACGT

AACCTGCTTTTAGCAGAACGACCCGTGAACTCGTTAAACAAACACATCGAGGGGGAGGTGAGGATGCCTACGCATGTGAGCCCTCCCTCT …

Pterospermum suberifolium voucher H.S. Cubey 127 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pterospermum suberifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 382×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1

CCDB · book-ipcn67-71 — POTY, J., & J.-L. HAMEL. 1968. Contribution a l'etude caryo- taxinomique des Sterculiacees. Mem. Mus. National Hist. Naturelle Ser. B. 18: 3-36.

CCDB · book-indian_vol1 — Poty, J. & Hamel, J .-L. 1968 ; Singhal, V.K. et al. 1980b

n 192×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Singhal, V. K. & B. S. Gill. 1987. Cytological studies in some woody members of Sterculiaceae. J. Cytol. Genet. 22: 95–101.

CCDB · ipcn-api-dl — Singhal, V. K., B. S. Gill & S. S. Bir. 1980a. In Chromosome number reports LXIX. Taxon 29: 712–713.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type35 records

Wild obs. + sensor18

Museum / vouchered17

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 8≤1 km 6>10 km 1

15 georeferenced · 3 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	12
Sri Ramaswamy Memorial Universitylocation not on record	3
Dekalb, US	1
St. Augustine, TT	1

4 institutions · 17 of 17 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Pterospermum suberifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 23.0–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 29.8–30.5

Min temp (night)19.3 °C 16.1–19.3

Precipitation109 mm/mo 33.2–109

Air humidity52.0 % 46.5–52.0

Moisture balance-17.8 mm/mo -87.7–-17.8

Vapour deficit1,616 Pa 1,525–1,616

Wind speed1.80 m/s 1.80–2.40

Cloud cover25.2 % 18.7–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)