Pterospermum acerifolium

(L.) Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Pterospermum

At a glance

Occurrence records498

Data sources13

Biological traits30

DNA specimens9

eDNA detections7

Sources13 archives

Databases and archives Pterospermum acerifolium's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility498 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources30 traits

Chemical compositionLOTUS · NPASS9 compounds

Occurrence & distributionGBIF498 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceCCDB2n = 38

01Narrative

翅子树（学名：），为梧桐科翅子树属下的一个种。台灣原生，產蘭嶼、綠島海岸林中。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height30 m

⚠ sources differ — GIFT: 30 m · TRY: 35 m

Plant height max30 m

Seed mass231 mg

Seed mass max231 mg

Seed mass min231 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dehiscencedehiscent

Dispersal typewind

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 300 m

Elevation min500 m

Epiphyteterrestrial

Fruit typecapsule

Growth formtree

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio33.36 g/g

Leaf c472 mg/g

Leaf n14.3 mg/g

Leaf p2.6 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.69 mm²/mg

Wood density622 mg/cm³

⚠ sources differ — TRY: 622 mg/cm³ · GIFT: 676 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition9 compounds

Compounds documented for Pterospermum acerifolium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols2

Flavones2

Acyclic monoterpenoids1

Megastigmanes1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(2R,3R,4R,5R,6S)-2-[[(2R,3S,4S,5R,6S)-6-[(3R)-3,7-dimethylocta-1,6-dien-3-yl]oxy-3,4,5-trihydroxyoxan-2-yl]methoxy]-6-methyloxane-3,4,5-triol	present	NPASS
(6R,9S)-3-Oxo-alpha-ionol glucoside	present	NPASS
BUFSOAPRBDGDFM-UHFFFAOYSA-N	present	NPASS
HCZHTFMXVNHARD-UHFFFAOYSA-N	present	NPASS
Kaempferide 7-glucoside	present	LOTUS
Lonicerin	present	NPASS
Luteolin 7-glucoside	present	NPASS
OMLSJIVZUANZTM-QOUKUZOOSA-N	present	NPASS
Tiliroside	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterospermum acerifolium has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes3

GenBank sequences9

eDNA detections7

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPP197660.1 ↗250 bpIndia · 2023

ACGT

CTCCTCTTAGCCCAAGTGTACAATTCCGTCAATTCTAGCCCCCACCTTTTTGGGGGACATGATTGATGGCCTCTTCTCTTGTGGCTTTAC …

Pterospermum acerifolium voucher KNPHD5 internal transcribed spacer region, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pterospermum acerifolium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 386×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +2

CCDB · ipcn-api-dl — Singhal, V. K. & B. S. Gill. 1987. Cytological studies in some woody members of Sterculiaceae. J. Cytol. Genet. 22: 95–101.

CCDB · ipcn-api-dl — Pal, R. K. 1973. Cytotaxonomy of the family Sterculiaceae. J. Cytol. Genet. 7–8: 98–105.

CCDB · book-ipcn67-71 — POTY, J., & J.-L. HAMEL. 1968. Contribution a l'etude caryo- taxinomique des Sterculiacees. Mem. Mus. National Hist. Naturelle Ser. B. 18: 3-36.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-indian_vol1 — Poty, J. & Hamel, J .-L. 1968 ; Mehra, P.N. & Sareen, T.S. 1973c

CCDB · book-atlas-flowering-plants — Pathak et al. 1949

n 195×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Singhal, V. K. & B. S. Gill. 1987. Cytological studies in some woody members of Sterculiaceae. J. Cytol. Genet. 22: 95–101.

CCDB · ipcn-api-dl — Pal, R. K. 1973. Cytotaxonomy of the family Sterculiaceae. J. Cytol. Genet. 7–8: 98–105.

CCDB · book-ipcn75-78 — Sharma 1970

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — MEHRA, P.N., & T.S. SAREEN. 1973. Cytology of some Himalayan trees. Silvae Genet. 22: 66-70.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type498 records

Wild obs. + sensor393

Museum / vouchered105

Origin

Introduced2

Range

Area of Occupancy AOO876 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 72≤1 km 19≤10 km 8>10 km 8

107 georeferenced · 286 without coordinates

Open the mapobservation + sensor393

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤1 km 13≤10 km 2

15 georeferenced · 90 without coordinates

Open the institutions mapphysical evidence105

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	16
Kunming, CN	9
Baroda, IN	9
Beijing, CN	5
Xiamen, CN	3
Zürich, CH	3
Tampa, US	3
HAWlocation not on record	3
Vancouver, CA	2
Dehra Dun, IN	2
Guilin, CN	2
Wuhan, CN	2
South Kensington, GB	2
Chengdu, CN	2
Guangzhou, CN	1
Kew, GB	1
UNESP, Campus São José Rio Prêtolocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Columbia, US	1
TAIElocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Pondicherry, IN	1
Durban, ZA	1
Herbarium of South China Botanical Gardenlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1
Fort Worth, US	1
QAUlocation not on record	1
Edinburgh, GB	1

29 institutions · 78 of 105 vouchered records shown · 27 without an institution code

09Environmental DNA7 detections

Where the DNA of Pterospermum acerifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.3 °C 18.6–28.1

Seasonal swing summer↔winter11.5 °C

Max temp (day)26.8 °C 22.6–31.0

Min temp (night)19.1 °C 13.5–24.6

Precipitation271 mm/mo 197–345

Air humidity64.5 % 63.5–65.5

Moisture balance142 mm/mo 90.9–193

Vapour deficit1,088 Pa 759–1,416

Wind speed2.80 m/s 2.00–3.60

Cloud cover35.0 % 28.2–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)