Pteronia pallens

L.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pteronia

At a glance

Occurrence records273

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Pteronia pallens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility273 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources13 traits

Occurrence & distributionGBIF273 records

DNA & barcodingNCBIsequences

01Narrative

Pteronia pallens ("Scholtzbos" or "Aasvoëlbos / Witbas") is a species of flowering plant in the family Asteraceae, indigenous to the Karoo regions of South Africa. Its natural habitat is dry, rocky slopes. It often cooccurs with its close relatives, Pteronia paniculata or Pteronia incana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology2

Plant height max1 m

Plant height min0.15 m

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Elevation max915 m

Elevation min305 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Specific leaf area (SLA)5.12 mm²/mg

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteronia pallens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392198.1 ↗569 bp

ACGT

TCGAAGCCTGCAAACAGAACGACCCGCGAACATGTTATAACAACCATGTGCCAAGATGGGTCGGGCGTCTGTTCGATCCTCGTGGCACGC …

Pteronia pallens voucher Zhigila & Schmeidel 1148 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type273 records

Wild obs. + sensor190

Museum / vouchered83

Range

Area of Occupancy AOO764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 124≤1 km 14≤10 km 4>10 km 7

149 georeferenced · 41 without coordinates

Open the mapobservation + sensor190

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤1 km 4≤10 km 1

5 georeferenced · 78 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	42
Cape Town, ZA	33
MeiseBGlocation not on record	2
South African National Biodiversity Institutelocation not on record	1
Zürich, CH	1
Christchurch, NZ	1
STUlocation not on record	1

7 institutions · 81 of 83 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)