Pteronia incana

(Burm.fil.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pteronia

At a glance

Occurrence records1 533

Data sources8

Biological traits16

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Pteronia incana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 533 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS23 compounds

Occurrence & distributionGBIF1 533 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Pteronia incana ("Asbos" or "ash-bush") is a species of flowering plant in the family Asteraceae, indigenous to the Karoo regions of South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height max1.5 m

Plant height min0.3 m

Seed mass2.34 mg

Seed mass max2.75 mg

Seed mass min1.95 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition23 compounds

Compounds documented for Pteronia incana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Halimane diterpenoids2

Germacrane sesquiterpenoids2

Tetracyclic diterpenoids2

Pinane monoterpenoids2

Bicyclogermacrane sesquiterpenoids $ Cyclogermacrane sesquiterpenoids2

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-alpha-Bisabolol	present	LOTUS
(1S,2E,10R)-3,7,11,11-tetramethylbicyclo[8.1.0]undeca-2,6-diene	present	LOTUS
(1S,2R,3R,5'S,6R,7R)-5'-(furan-3-yl)-3,6,7-trimethylspiro[9-oxatricyclo[5.2.2.01,6]undecane-2,3'-oxolane]-2',8-dione	present	LOTUS
(1S,4R,6R,8S,9S,12S,14S,16R)-14-(furan-3-yl)-16-hydroxy-8,9,12-trimethyl-3,7,13-trioxapentacyclo[7.6.1.01,12.04,16.06,8]hexadecan-2-one	present	LOTUS
(2Z,6E,11R)-3,11,15-tris(hydroxymethyl)-7-methylhexadeca-2,6-diene-1,16-diol	present	LOTUS
(3E,5R)-3-[(4aS,5R,6R,8aS)-5,6,8a-trihydroxy-4a,5-dimethyl-1,3,4,6,7,8-hexahydronaphthalen-2-ylidene]-5-(furan-3-yl)oxolan-2-one	present	LOTUS
(3E,5R)-3-[4-[(1R,2R,3R)-2,3-dihydroxy-1,2-dimethyl-6-oxocyclohexyl]butan-2-ylidene]-5-(furan-3-yl)oxolan-2-one	present	LOTUS
(3R,3aS,5'R,6R,7R)-5'-(furan-3-yl)-3-(hydroxymethyl)-3,3a,6-trimethylspiro[2,4,5,6-tetrahydroindene-7,3'-oxolane]-2'-one	present	LOTUS
(3R,4R,4aR,5'R,7S,8R,8aR)-5'-(furan-3-yl)-3,4,7,8a-tetrahydroxy-4,4a,7-trimethylspiro[2,3,5,6-tetrahydro-1H-naphthalene-8,3'-oxolane]-2'-one	present	LOTUS
(3R,4R,4aS,5'R,7R,8R,8aR)-5'-(furan-3-yl)-3,4,8a-trihydroxy-4,4a,7-trimethylspiro[1,2,3,5,6,7-hexahydronaphthalene-8,3'-oxolane]-2'-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pteronia incana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR392196.1 ↗568 bp

ACGT

TCGAAGCCTGCAAACAGAACGACCCGCGAACATGTTATAACAACCACGTGCCAGGATGGGTCGAACGTCTGTTCGATCCTCGTGGCACGC …

Pteronia incana voucher Zhigila & Muasya 1203 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcLa★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 533 records

Wild obs. + sensor1 158

Museum / vouchered374

Cultivated / captive1

Range

Area of Occupancy AOO3 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 806≤1 km 75≤10 km 19>10 km 40

940 georeferenced · 218 without coordinates

Open the mapobservation + sensor1 158

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤1 km 7≤10 km 1>10 km 1

9 georeferenced · 365 without coordinates

Open the institutions mapphysical evidence374

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	172
Cape Town, ZA	152
Stockholm, SE	6
Bronx, US	6
University of Stellenboschlocation not on record	5
MeiseBGlocation not on record	4
Kew, GB	3
GHPG$location not on record	2
Philadelphia, US	2
MSB-3054location not on record	2
MSB-3159location not on record	2
Vancouver, CA	1
MAlocation not on record	1
University of Johannesburglocation not on record	1
South African National Biodiversity Institutelocation not on record	1
Canadian Department of Agriculturelocation not on record	1
Uppsala, SE	1

17 institutions · 362 of 374 vouchered records shown · 12 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Pteronia incana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.8–14.8

Seasonal swing summer↔winter11.3 °C

Max temp (day)20.0 °C

Min temp (night)9.20 °C

Precipitation35.8 mm/mo

Air humidity57.5 %

Moisture balance-68.9 mm/mo

Vapour deficit713 Pa

Wind speed4.00 m/s

Cloud cover12.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pteronia incana

At a glance

Sources8 archives

Size & morphology5

Life cycle & reproduction1

Diet & foraging1

Habitat & environment8

Other traits1

Compound class profile5 classes

Documented compounds23 total

At a glance

Record type1 533 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 17 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 533 records