Pterocladia lucida

(R.Brown ex Turner) J.Agardh · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Gelidiales/Pterocladiaceae/Pterocladia

At a glance

Occurrence records6 499

Data sources6

Biological traits2

DNA specimens54

eDNA detections6

Sources6 archives

Databases and archives Pterocladia lucida's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 717 records↗

OBISOcean Biodiversity Information System3 782 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS6 499 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI54 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterocladia lucida has left across the world's sequence archives.

At a glance

DNA specimens54

BINs5

Marker genes4

GenBank sequences10

eDNA detections6

The DNA barcodea real sequence read deposited for this species

rbcLMK125409.1 ↗1 271 bpAustralia

ACGT

TGCTAGCATTATTCCGAGTTAGTCCACAACCTGGAGTAGATCCTGTAGAAGCATCAGCAGCTGTTGCTGGTGAATCATCAACGGCTACCT …

Pterocladia lucida voucher HV06214 bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pseudopolyides furcellatussame order16.0%Polysiphonia polysporasame order16.4%Hypnea pannosasame order16.5%Phitymophora amansioidessame order16.5%Cryptonemia undulatasame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL10★ITS128S

animal barcodeplant barcodefungal barcodemarker

08Occurrence & distribution

Record type6 499 records

Wild obs. + sensor5 107

Museum / vouchered1 353

Other39

Origin

Native76

Range

Area of Occupancy AOO2 820 km²

Depth

0–200 m sunlit377

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 6 m · max 132 m · 377 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5 014≤1 km 52≤10 km 6>10 km 1

5 073 georeferenced · 34 without coordinates

Open the mapobservation + sensor5 107

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 33≤1 km 237≤10 km 502>10 km 45

817 georeferenced · 536 without coordinates

Open the institutions mapphysical evidence1 353

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	287
Wellington, NZ	254
Auckland, NZ	195
Museo Entomologico de Leonlocation not on record	170
Kensington, AU	84
Mount Annan, AU	72
Chapel Hill, US	66
Bronx, US	32
Ann Arbor, US	14
LDlocation not on record	12
WTUlocation not on record	12
Christchurch, NZ	10
Hobart, AU	8
GRAlocation not on record	8
Brisbane, AU	7
Australian Institute of Marine Sciencelocation not on record	5
Tampa, US	5
Acadia Universitylocation not on record	4
Canberra, AU	4
New Haven, US	3
John T. Waterhouse Herbariumlocation not on record	3
Parkville, AU	3
PHlocation not on record	3
University of New Brunswick, Frederictonlocation not on record	3
James Cook Townsvillelocation not on record	2
FLASlocation not on record	2
Durham, US	2
University of Stellenboschlocation not on record	2
Brown Universitylocation not on record	1
USP-IBlocation not on record	1
QVMAGlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Durham, US	1
Buenos Aires, AR	1
Arcata, US	1
Burlington, US	1
US	1

37 institutions · 1 281 of 1 353 vouchered records shown · 62 without an institution code

09Environmental DNA6 detections

Where the DNA of Pterocladia lucida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 9.00–21.9

Seasonal swing summer↔winter15.4 °C

Max temp (day)23.3 °C 11.9–28.5

Min temp (night)15.0 °C 5.50–15.2

Precipitation22.0 mm/mo 15.6–99.7

Air humidity51.6 % 43.4–61.8

Moisture balance-44.1 mm/mo

Vapour deficit1,191 Pa 478–1,624

Wind speed5.00 m/s

Cloud cover18.1 % 16.9–32.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pterocladia lucida

At a glance

Sources6 archives

Habitat & environment2

At a glance

Record type6 499 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 499 records