Pterocaulon sphacelatum

(Labill.) F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Pterocaulon

At a glance

Occurrence records3 438

Data sources10

Biological traits43

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Pterocaulon sphacelatum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 438 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources43 traits

Chemical compositionLOTUS · NPASS7 compounds

Occurrence & distributionGBIF3 438 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaTgenome

01Narrative

Pterocaulon sphacelatum là một loài thực vật có hoa trong họ Cúc. Loài này được (Labill.) F.Muell. miêu tả khoa học đầu tiên năm 1882.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology18

Fruit length0.7 mm

Leaf length40 mm

Leaf length max50 mm

Leaf length min10 mm

Leaf mass29.13 mg

Leaf mass per area84.13 g/m2

Leaf size377 mm²

Leaf width12.74 mm

Leaf width max15 mm

Leaf width min3 mm

Plant height0.6 m

Plant height max1.2 m

Plant height min0.2 m

Seed length0.64 mm

Seed mass0.032 mg

⚠ sources differ — TRY: 0.032 mg · AusTraits: 0.03 mg · GIFT: 0.037 mg

Seed mass max0.05 mg

Seed mass min0.03 mg

Seed width0.28 mm

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typewind

Flowering timennnnnnyyyynn

Life formbiennial or perennial

Life spanperennial

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityresprouts

Sex typegynomonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typeachene

Growth formherb

Habitat GIFTSavanna, dense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapeoblanceolate obovate

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Pterocaulon sphacelatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Pyridine alkaloids4

Flavonols1

Simple coumarins1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
9,10-Dehydrofusaric acid methyl ester	present	NPASS
Chrysosplenol C	present	LOTUS
Dehydrofusaric acid	present	NPASS
Diethanolamine	present	LOTUS
Fusaric Acid	present	NPASS
Fusaric acid methyl ester	present	NPASS
Scoparone	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterocaulon sphacelatum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSJX564750.1 ↗717 bp

ACGT

CAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCATAGCAGAACGACCCGAGAACCTGTACAAATTGTCTGGTGTC …

Pterocaulon sphacelatum isolate ASL422 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Pterocaulon sphacelatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Ploidydiploid inferred

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 438 records

Wild obs. + sensor1 716

Museum / vouchered1 648

Cultivated / captive8

Other66

Origin

Native671

Introduced1

Range

Area of Occupancy AOO10 368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 849≤1 km 115≤10 km 56>10 km 28

1 048 georeferenced · 668 without coordinates

Open the mapobservation + sensor1 716

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 438≤1 km 282≤10 km 644>10 km 159

1 523 georeferenced · 125 without coordinates

Open the institutions mapphysical evidence1 648

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy25% within 1 km

≤100 m 1≤1 km 1≤10 km 6

8 georeferenced

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	405
Kensington, AU	225
Palmerston, AU	223
Canberra, AU	182
Brisbane, AU	171
Museo Entomologico de Leonlocation not on record	136
Mount Annan, AU	131
Kew, GB	23
Armidale, AU	18
John T. Waterhouse Herbariumlocation not on record	12
Smithfield, AU	11
Hobart, AU	11
James Cook Townsvillelocation not on record	4
University of Stellenboschlocation not on record	4
NSW Dept of Planning, Industry and Environmentlocation not on record	4
Wellington, NZ	2
Claremont, US	2
Canadian Department of Agriculturelocation not on record	1
EL PASO, US	1
Christchurch, NZ	1
Paris, FR	1
Auckland, NZ	1
JBRJlocation not on record	1
Stockholm, SE	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1

25 institutions · 1 572 of 1 648 vouchered records shown · 76 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Pterocaulon sphacelatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Pterocaulon sphacelatum

At a glance

Sources10 archives

Size & morphology18

Life cycle & reproduction10

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

Compound class profile3 classes

Documented compounds7 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 438 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type3 438 records