Pterocarpus soyauxii

Taub. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Pterocarpus

At a glance

Occurrence records885

Data sources10

Biological traits28

DNA specimens5

eDNA detections2

Sources10 archives

Databases and archives Pterocarpus soyauxii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility885 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS13 compounds

Occurrence & distributionGBIF885 records

Environmental DNA1 datasets · 2 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

A bonsai stand made from African padauk wood Pterocarpus soyauxii, the African padauk or African coralwood, is a species of Pterocarpus in the family Fabaceae, native to central and tropical west Africa, from Nigeria east to Congo-Kinshasa and south to Angola.International Legume Database & Information Service: Pterocarpus soyauxii It is a tree growing to 27–34 m tall, with a trunk diameter up to 1 m with flaky reddish-grey bark. The leaves are pinnate, with 11–13 leaflets. The flowers are produced in panicles. The fruit is a thorny pod 6–9 cm long, which does not split open at maturity.World Agroforestry Centre: Pterocarpus soyauxii

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height35 m

⚠ sources differ — GIFT: 35 m · TRY: 21.2 m

Plant height max30.48 m

Seed mass179 mg

Life cycle & reproduction7

Deciduousnessdeciduous

Flowering endJan

Flowering startJan

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTprimary forest

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio16.74 g/g

Leaf c451 mg/g

Leaf dry-matter content (LDMC)298 mg/g

Leaf n27.1 mg/g

Leaf p0.818 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density659 mg/cm³

Other traits2

Fruiting endvariable

Fruiting startvariable

03Chemical composition13 compounds

Compounds documented for Pterocarpus soyauxii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Isoflavones4

Pterocarpan4

Isoflavanones2

Monomeric stilbenes2

Cyanogenic glycosides1

Documented compounds13 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-phenyl-2-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyacetonitrile	present	LOTUS
(3R)-Claussequinone	present	LOTUS
(R)-Mucronulatol	present	LOTUS
3,8-Dihydroxy-9-methoxypterocarpan	present	LOTUS
4-(2-(3,5-Dimethoxyphenyl)ethenyl)phenol	present	LOTUS
7,3'-Di-O-methylorobol	present	LOTUS
8-Hydroxy-3,9-dimethoxypterocarpan	present	LOTUS
Aek7QS8V99	present	LOTUS
Formononetin	present	LOTUS
Prunetin	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterocarpus soyauxii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes5

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR606392.1 ↗267 bp

ACGT

CCACACGGGCAGGCGATGCTGCTGCTCGGCAGCTCGGCTACCCCCGGTGCCGGGGCGGGCACCACGCCCCCGTGCGTGCGGGTCTCGTCC …

Pterocarpus soyauxii isolate Ps8 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS9trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type885 records

Wild obs. + sensor239

Museum / vouchered646

Range

Area of Occupancy AOO1 384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 238 without coordinates

Open the mapobservation + sensor239

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 11>10 km 8

19 georeferenced · 627 without coordinates

Open the institutions mapphysical evidence646

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LBVlocation not on record	121
MeiseBGlocation not on record	111
BRLUlocation not on record	106
Saint Louis, US	46
WAGlocation not on record	28
Yaoundé, CM	21
Paris, FR	19
Kew, GB	15
Herbier National du Gabonlocation not on record	14
Adam Mickiewicz University in Poznańlocation not on record	12
University of Santo Tomas Museumlocation not on record	12
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	9
IPHAMETRAlocation not on record	6
Plocation not on record	6
Bronx, US	5
University of Stellenboschlocation not on record	5
MAlocation not on record	4
Brussels, BE	4
Beijing, CN	2
Philadelphia, US	2
University of Oxfordlocation not on record	2
LDlocation not on record	2
Stockholm, SE	1
Glocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
PHlocation not on record	1
Instituto de Investigação Científica Tropicallocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
National Botanical Gardens of Belgiumlocation not on record	1
Elocation not on record	1
Edinburgh, GB	1

31 institutions · 561 of 646 vouchered records shown · 85 without an institution code

09Environmental DNA2 detections

Where the DNA of Pterocarpus soyauxii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 24.2–24.9

Seasonal swing summer↔winter1.90 °C

Max temp (day)29.5 °C 29.4–29.7

Min temp (night)21.0 °C 20.4–21.6

Precipitation115 mm/mo 56.7–174

Air humidity65.8 % 63.8–67.8

Moisture balance-2.50 mm/mo -65.6–60.5

Vapour deficit1,055 Pa 1,010–1,101

Wind speed1.30 m/s 1.00–1.50

Cloud cover55.1 % 54.0–56.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)