Pterocarpus santalinus

L.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Pterocarpus

At a glance

Occurrence records89

Data sources11

Biological traits17

DNA specimens17

eDNA detections14

Sources11 archives

Databases and archives Pterocarpus santalinus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility89 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS · NPASS99 compounds

Occurrence & distributionGBIF89 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI17 specimens

Genome at a glanceGoaT · NCBI≈624 Mbp

01Narrative

Pterocarpus santalinus, le faux-santal rouge, est une espèce de plantes à fleurs de la famille des Fabacées. C'est un arbre endémique de la chaîne des Ghats orientaux, dans l'Est de l’Inde. Cet arbre est apprécié pour la riche couleur rouge de son bois. Celui-ci est particulièrement recherché en Chine, où c'est une essence associée à l'ébénisterie de la période Qing. Le bois n’est pas aromatique. L’arbre est à ne pas confondre avec les arbres de bois de santal Santalum aromatiques qui poussent dans le Sud de l’Inde.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height15 m

⚠ sources differ — GIFT: 15 m · TRY: 20 m

Seed mass500 mg

Life cycle & reproduction5

Deciduousnessdeciduous

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density1 019 mg/cm³

03Chemical composition99 compounds

Compounds documented for Pterocarpus santalinus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids11

Kaurane and Phyllocladane diterpenoids9

Oleanane triterpenoids8

Neoflavonoids7

Eudesmane sesquiterpenoids6

Documented compounds99 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Savinin	present	LOTUS
(1R,2R,4R,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5,9-bis(hydroxymethyl)-5-methyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-15-one	present	NPASS
(1R,2R,4R,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5-(hydroxymethyl)-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecan-15-one	present	NPASS
(1R,2R,4S,5S,8S,9R,10S,13S,16R)-2,8,16-trihydroxy-5,9-dimethyl-14-methylidene-15-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,2R,4S,5S,9S,10S,13S,16R)-2,16-dihydroxy-9-(hydroxymethyl)-5-methyl-14-methylidene-15-oxotetracyclo[11.2.1.01,10.04,9]hexadecane-5-carbaldehyde	present	NPASS
(1R,3aR,5aR,5bR,7aR,11aR,11bR,13aR,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-9-one	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9R,10R,11aR,11bR,13aR,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-9,10-diol	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9R,11aR,11bR,13aR,13bS)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9R,11aS,11bR,13aS,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS
(1R,3aR,5aR,5bR,7aR,9S,11aS,11bR,13aR,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterocarpus santalinus has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes4

GenBank sequences10

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX051735.1 ↗458 bpIndia · 2024

ACGT

TGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTAAGGGCACGCCTGCCTGGGTGTC …

Pterocarpus santalinus voucher CCRUM 1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL5★ITS1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Pterocarpus santalinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈623 865 624 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Pterocarpus santalinus0.62 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type89 records

Wild obs. + sensor58

Museum / vouchered31

Range

Area of Occupancy AOO296 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy8% within 1 km

≤1 km 4≤10 km 6>10 km 40

50 georeferenced · 8 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	7
Tampa, US	3
Sri Ramaswamy Memorial Universitylocation not on record	3
Miami, US	2
Saint Louis, US	2
Taipei, TW	1
Uppsala, SE	1
South Kensington, GB	1
Gujarat Biodiversity Gene Banklocation not on record	1
Nishihara, JP	1
TAIElocation not on record	1

11 institutions · 23 of 31 vouchered records shown · 8 without an institution code

09Environmental DNA14 detections

Where the DNA of Pterocarpus santalinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 22.9–25.1

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 29.5–30.5

Min temp (night)19.3 °C 16.1–19.3

Precipitation109 mm/mo 33.2–109

Air humidity52.0 % 47.3–52.0

Moisture balance-17.8 mm/mo -85.9–-17.8

Vapour deficit1,616 Pa 1,493–1,616

Wind speed1.80 m/s 1.80–2.30

Cloud cover25.2 % 19.1–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)