Pterocarpus osun

Craib · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Pterocarpus

At a glance

Occurrence records68

Data sources7

Biological traits12

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Pterocarpus osun's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionNPASS8 compounds

Occurrence & distributionGBIF68 records

DNA & barcodingNCBIsequences

01Narrative

Pterocarpus osun est une espèce de plantes à fleurs de la famille des Fabaceae. C'est un arbre trouvé en Afrique de l'Ouest.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height18 m

Life cycle & reproduction4

Deciduousnessvariable

Dispersal typewind

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density680 mg/cm³

03Chemical composition8 compounds

Compounds documented for Pterocarpus osun across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iridoids monoterpenoids6

Pterocarpan1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
BUIDBCJSSFEBDL-PQGHUMCWSA-N	present	NPASS
methyl (1S,2S,4S,5R,6S,7S)-5-hydroxy-5-(hydroxymethyl)-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,8-dioxatricyclo[4.4.0.02,4]dec-9-ene-10-carboxylate	present	NPASS
methyl (1S,4aS,5R,7R,7aS)-5,7-dihydroxy-7-(hydroxymethyl)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	NPASS
methyl (1S,4aS,5R,7R,7aS)-7-(acetyloxymethyl)-5,7-dihydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	NPASS
methyl (1S,4aS,6S,7R,7aS)-6,7-dihydroxy-7-(hydroxymethyl)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	NPASS
methyl (1S,4aS,7R,7aS)-7-(acetyloxymethyl)-7-hydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,5,6,7a-tetrahydro-1H-cyclopenta[c]pyran-4-carboxylate	present	NPASS
methyl (1S,4aS,7R,7aS)-7-(acetyloxymethyl)-7-hydroxy-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4a,7a-dihydro-1H-cyclopenta[c]pyran-4-carboxylate	present	NPASS
Pterocarpin	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterocarpus osun has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN083498.1 ↗345 bpNigeria · 1985

ACGT

AGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCTAAGG …

Pterocarpus osun isolate 25555 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor43

Museum / vouchered20

Other5

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the mapobservation + sensor43

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yaoundé, CM	3
Leiden University Medical Centerlocation not on record	3
Kew, GB	2
Saint Louis, US	2
Bronx, US	1
Paris, FR	1
MeiseBGlocation not on record	1
South Kensington, GB	1
Edinburgh, GB	1

9 institutions · 15 of 20 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)