Pterocarpus marsupium

Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Pterocarpus

At a glance

Occurrence records474

Data sources14

Biological traits23

DNA specimens23

eDNA detections14

Sources14 archives

Databases and archives Pterocarpus marsupium's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility474 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS134 compounds

Occurrence & distributionGBIF474 records

Environmental DNA1 datasets · 1 countries14 detections

DNA & barcodingBOLD · NCBI23 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Pterocarpus marsupium, also known as Malabar kino, Indian kino, Vijayasar, or Venkai is a medium to large, deciduous tree that can grow up to 31 m tall. It is native to India (where it occurs in parts of the Western Ghats in the Karnataka-Kerala region and in the forests of Central India), Nepal, and Sri Lanka. ''Pterocarpus marsupium'' bark ''Pterocarpus marsupium'' tree ''Pterocarpus marsupium'' seeds ([[Kunming Botanical Garden]])

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height25 m

⚠ sources differ — GIFT: 25 m · TRY: 30 m

Seed mass571 mg

⚠ sources differ — TRY: 571 mg · GIFT: 655 mg

Seed mass max952 mg

Seed mass min500 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Mycorrhiza typenon-ectomycorrhizal

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio17.94 g/g

Leaf c430 mg/g

Leaf n22.45 mg/g

Leaf p0.95 mg/g

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)9.51 mm²/mg

Wood density620 mg/cm³

03Chemical composition134 compounds

Compounds documented for Pterocarpus marsupium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Chalcones11

Isoflavones11

Aurones9

Flavanones6

Flavonols3

Documented compounds134 total

Tissue Source Quantified only

Compound	Amount	Source
KINOTANNIC-ACID	800,000 ppm	DukesPhytochem
WATER	788,000 ppm	DukesPhytochem
ASH	75,000 ppm	DukesPhytochem
POTASH	25,000 ppm	DukesPhytochem
NITROGEN	25,000 ppm	DukesPhytochem
RESIN	9,000 ppm	DukesPhytochem
PHOSPHORIC-ACID	4,000 ppm	DukesPhytochem
ALKALOIDS	170 ppm	DukesPhytochem

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Pterocarpus marsupium has left across the world's sequence archives.

At a glance

DNA specimens23

Marker genes3

GenBank sequences10

eDNA detections14

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX057184.1 ↗462 bpIndia · 2024

ACGT

AATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTCAGGCCGAGGGCACGTCTGCCTGGGTGTCACGC …

Pterocarpus marsupium voucher CCRUM 2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Pterocarpus marsupium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidypolyploid inferred

Chromosome records22–442n range33median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Kumari, S. & S. S. Bir. 1990. Karyomorphological evolution in Papilionaceae. J. Cytol. Genet. 25: 173–219.

CCDB · book-indian_vol1 — Bir, S .S ., Kumari, S. & Sunita 1980

2n 442×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Atchison, E. 1951

CCDB · book-atlas-flowering-plants

n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bir, S. S., S. Kumari & Sunita. 1980b. In Chromosome number reports LXIX. Taxon 29: 711.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.850 ↗

08Occurrence & distribution

Record type474 records

Wild obs. + sensor419

Museum / vouchered53

Other2

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 12≤1 km 1≤10 km 1>10 km 86

100 georeferenced · 319 without coordinates

Open the mapobservation + sensor419

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3≤10 km 1

4 georeferenced · 49 without coordinates

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pondicherry, IN	13
Institute of Forest Genetics and Tree Breedinglocation not on record	9
Baroda, IN	4
St. Augustine, TT	3
University of Stellenboschlocation not on record	2
Gujarat Biodiversity Gene Banklocation not on record	1
Taipei, TW	1
McWane Science Centerlocation not on record	1
Uppsala, SE	1
LDlocation not on record	1
South Kensington, GB	1

11 institutions · 37 of 53 vouchered records shown · 16 without an institution code

09Environmental DNA14 detections

Where the DNA of Pterocarpus marsupium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map1 country0

Natural forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–22.1

Seasonal swing summer↔winter4.00 °C

Max temp (day)25.5 °C 25.5–26.0

Min temp (night)17.7 °C 17.7–17.8

Precipitation149 mm/mo 135–149

Air humidity66.8 % 64.8–66.8

Moisture balance21.5 mm/mo 9.20–21.5

Vapour deficit867 Pa 867–943

Wind speed1.50 m/s 1.50–1.60

Cloud cover23.4 % 21.8–23.4

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)